Inspectors and Teachers perceptions of a good English lesson

Inspectors and Teachers perceptions of a good English lesson

Inspectors and Teachers perceptions of a good English lesson

... tài: Inspectors and Teachers perceptions of a good English lesson Nhận thức c a giáo viên và thanh tra về 1 giờ tiếng Anh tốt Câu hỏi phỏng vấn giáo viên và thanh tra về các tiêu chí c a 1 giờ ... tiếng Anh tốt Câu hỏi 1: Bộ GD&ĐT có hướng dẫn về các tiêu chí đánh giá, xếp loại giờ dạy. Thầy (cô) có ý kiến gì về các tiêu chí đó ? - Có bao quát được các mặt cần thiết c a...

Ngày tải lên: 17/10/2013, 10:11

2 539 0
A study on syntactic, semantic and pragmatic features of exaggeration in english and vietnamese

A study on syntactic, semantic and pragmatic features of exaggeration in english and vietnamese

... is paid to analyzing and categorizing the data syntactically, semantically and pragmatically. 3.6 RELIABILITY AND VALIDITY Reliability and validity are two most important criteria to guarantee ... syntactic, semantic and pragmatic features of exaggeration in English and Vietnamese? - What are the similarities and differences of exaggeration used in English and V...

Ngày tải lên: 26/11/2013, 13:16

13 1,6K 4
Effect of unsaturated fatty acid esters of biodiesel fuels on combustion, performance and emission characteristics of a DI diesel engine

Effect of unsaturated fatty acid esters of biodiesel fuels on combustion, performance and emission characteristics of a DI diesel engine

... hand it was found strange while investigating the relationship between percentage of unsaturation, maximum heat release rate and peak pressure for karanjia biodiesel. Biodiesel of karanjia has ... karanjia has a lower percentage of unsaturation and has a higher value of maximum heat release rate than those of sunflower biodiesel, but still has a lower value of peak press...

Ngày tải lên: 05/09/2013, 15:28

20 483 0
An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends

An experimental investigation of performance and exhaust emission of a diesel engine fuelled with Jatropha biodiesel and its blends

... Energy and Environment, Rajiv Gandhi Proudyogiki Vishwavidyalaya, Bhopal, India. Abstract An experimental investigation has been carried out to examine the Performance parameters and exhaust emission ... states of India have reserve a total of 1.72 million hectares of land for Jatropha cultivation and small quantities of Jatropha biodiesel are already being sold to the public...

Ngày tải lên: 05/09/2013, 16:11

12 568 0
Optimization of injection timing and injection pressure of a DI diesel engine fueled with preheated rice bran oil

Optimization of injection timing and injection pressure of a DI diesel engine fueled with preheated rice bran oil

... Ramabrahamam. B.V, Nagarajan.G, Mahua (Madhuca indica) seed oil: A source of renewable energy in India, Journal of Scientific and Industrial Research 64, (November 2005): 890 – 896. R. Raghu has ... Strayer RC, Craig WK, Zoerb GC. Engine deposit and pour point studies using canola oil as a Diesel fuel. ASAE, 49085, 1982, p. 349. [12] Deepak Agarwal, Avinash Kumar Agarwal, Performa...

Ngày tải lên: 05/09/2013, 16:11

10 552 0
Tài liệu tiếng anh Điện tử công suất mạch MERS Loss and rating consideration of a wind energy conversion system with reactive compensation by magnetic energy recovery switch

Tài liệu tiếng anh Điện tử công suất mạch MERS Loss and rating consideration of a wind energy conversion system with reactive compensation by magnetic energy recovery switch

... TOKYO INSTITUTE OF TECHNOLOGY. Downloaded on November 25, 2008 at 23:56 from IEEE Xplore. Restrictions apply. Authorized licensed use limited to: TOKYO INSTITUTE OF TECHNOLOGY. Downloaded on November ... 2008 at 23:56 from IEEE Xplore. Restrictions apply. Authorized licensed use limited to: TOKYO INSTITUTE OF TECHNOLOGY. Downloaded on November 25, 2008 at 23:56 from IEEE Xplore. Restric...

Ngày tải lên: 15/10/2013, 16:11

6 802 0
Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

Tài liệu Báo cáo khoa học: Isolation and molecular characterization of a novel D-hydantoinase from Jannaschia sp. CCS1 docx

... (1988) Stereo- and substrate-specificity of a d-hydantoinase and a d-N-carbamyl amino acid amidohydrolase of Arthrobacter crystallopoietes AM 2. Enzyme Microb Technol 10, 618–625. 12 Ogawa J & Shimizu ... flow rate was set to 0.8 mL Æmin )1 . The subunit molecular mass was also estimated by SDS–PAGE. Characterization and comparative analyses of HYD Js and HYD Bp The optima...

Ngày tải lên: 18/02/2014, 08:20

14 621 0
Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

Tài liệu Báo cáo khoa học: Purification and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... 275–283. 10 Kuwada M, Teramoto T, Kumagaye KY, Nakajima K, Watanabe T, Kawai T, Kawakami Y, Niidome T, Sawada K, Nishizawa Y et al. (1994) Omega-agatoxin- TK containing D-serine at position 46, but ... crosspeaks were assigned and inte- grated, with concomitant cycles of structure calcula- tions for evaluation of distance and angle constraint violations as well as assignments of add...

Ngày tải lên: 18/02/2014, 17:20

12 617 0
Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

Tài liệu Báo cáo khoa học: Structural and biochemical characterization of a human adenovirus 2/12 penton base chimera pptx

... sites using a forward oligomer 5¢-CTTTATTTTCAGGGCGCCATGAAGCGCG CAAGACCGTCTGAA-3¢ and a reverse oligomer 5¢-AGCT CGAATTCG GATCCGGTACCTCAGAAGGTAGACAG CAGAACC-3¢. For derivitization with TMR, a Gly-Gly-Cys sequence ... chain and hides a large amount of the hydrophobic surface area. Surface area calculations for the pentamer give a total surface area of  81 000 A ˚ 2 with 30%...

Ngày tải lên: 19/02/2014, 06:20

10 648 0
w