Báo cáo y học: "The Diels-Alder-Reaction with inverse-Electron-Demand, a very efficient versatile Click-Reaction Concept for proper Ligation of variable molecular Partners"

Báo cáo y học: "The Diels-Alder-Reaction with inverse-Electron-Demand, a very efficient versatile Click-Reaction Concept for proper Ligation of variable molecular Partners"

Báo cáo y học: "The Diels-Alder-Reaction with inverse-Electron-Demand, a very efficient versatile Click-Reaction Concept for proper Ligation of variable molecular Partners"

... Diels-Alder-Reaction with inverse-Electron-Demand, a very efficient versatile Click-Reaction Concept for proper Ligation of variable molecular Partners Manfred Wiessler1, Waldemar Waldeck2, Christian Kliem1, ... study reveals the kinetic pathway for an interfacial reaction. Journal of the American Chemical Society. 2004; 126: 15613-7. 23. Pozsgay V, Vieira...
Ngày tải lên : 26/10/2012, 09:39
  • 10
  • 623
  • 0
Báo cáo y học: "The Influence of Hyperbaric Oxygen Treatment on the Healing of Experimental Defects Filled with Different Bone Graft Substitutes"

Báo cáo y học: "The Influence of Hyperbaric Oxygen Treatment on the Healing of Experimental Defects Filled with Different Bone Graft Substitutes"

... Choongnam, Korea) bone graft materials were placed using an amalgam carrier to ensure that an equal volume of each material was used for each rat. Same graft material was used ... therapy alternatives are important areas of research. Hyperbaric oxygen therapy (HBOT) is a mode of medical treatment in which the patient breathes 100 % oxygen at a pressure great...
Ngày tải lên : 25/10/2012, 11:15
  • 12
  • 698
  • 0
Tài liệu Báo cáo Y học: The Ikaros family protein Eos associates with C-terminal-binding protein corepressors pptx

Tài liệu Báo cáo Y học: The Ikaros family protein Eos associates with C-terminal-binding protein corepressors pptx

... laboratory and Margot Kearns for reading the manuscript. We thank Dr R .A. Shivdasani for his gift of a TRPS encoding plasmid. This work was supported by a grant from the Australian Health Management ... containing 10 lg primary antibody. After a wash with 4 · 100 mL Tris/ NaCl/Tween, the secondary antibody solution was added and incubation was continued for 1 h. The membrane...
Ngày tải lên : 21/02/2014, 01:21
  • 8
  • 334
  • 0
Báo cáo Y học: The inhibitory region of troponin-I alters the ability of F-actin to interact with different segments of myosin pot

Báo cáo Y học: The inhibitory region of troponin-I alters the ability of F-actin to interact with different segments of myosin pot

... 91, 2861–2865. 19.Geisterfer-Lowrance ,A. A.T.,Kass,S.,Tanigawa,G.,Vosberg, H.P.,McKenna,W.,Seidman,C.E.&Seidman,J.G.(1990 )A molecular basis for familial hypertrophic cardiomyopathy – a beta-cardiac myosin heavy-chain gene missense mutation. Cell 62, 999–1006. 20. Cuda, ... (C-terminal to IP) AKESLDLRAHLKQVKKEDTEK hcM398–414 (myosin loop) GLCHPRVKVGNEYVTKG rsMLC1 1–37 (MLC1) APKKD...
Ngày tải lên : 17/03/2014, 10:20
  • 13
  • 524
  • 0
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf

... Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC Reverse CATTTTGTCCGCCAAGACTTTTGAATACTT TCAAGTGC Q76G Forward CTTCCCGGAGGAAATGAGGACTTGGTACTTACTG Reverse CCTCATTTCCTCCGGGAAGACTTTTGAATA C N77G Forward ... Sequence Standard All Forward GCTCAGGCGACCATGGGCCATCATCATC Reverse CTTGCATGCCCTGCAGGTCG Mutagenic L73G Forward GTATTCAAAAGTGGTCCCGGACAAAATGAG GACTTG Reverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTA...
Ngày tải lên : 17/03/2014, 10:20
  • 10
  • 533
  • 0
Báo cáo Y học: The amyloid precursor protein interacts with neutral lipids Liposomes and monolayer studies pdf

Báo cáo Y học: The amyloid precursor protein interacts with neutral lipids Liposomes and monolayer studies pdf

... case for the interaction of APP with PtdCho monolayers. We investigated whether the observed changes are due to conformational changes of APP, associated with secondary, tertiary or quaternary ... by measurement of 125 I-labeled APP radioactivity. Percentage incorporation was defined as the ratio between the radioactivity recovered in liposomal fractions and the total radioactivity...
Ngày tải lên : 31/03/2014, 21:21
  • 9
  • 436
  • 0
Báo cáo Y học: Structural study on lipid A and the O-specific polysaccharide of the lipopolysaccharide from a clinical isolate of Bacteroides vulgatus from a patient with Crohn’s disease ppt

Báo cáo Y học: Structural study on lipid A and the O-specific polysaccharide of the lipopolysaccharide from a clinical isolate of Bacteroides vulgatus from a patient with Crohn’s disease ppt

... R-(+)-butan-2-ol [8]. Fatty acids were analyzed by the method of Ikemoto et al. [17]. Alditol acetate, partially methylated alditol acetate, acetylated butyl glycoside and fatty acid methyl ester ... OPS-rich fraction on analysis of the sugar constituents (Table 1). The approximate molar ratio of Rha to Man was 1 : 1. Abso- lute configuration analysis demonstrated that Man has a D confi...
Ngày tải lên : 31/03/2014, 23:20
  • 7
  • 437
  • 0
Báo cáo y học: "The Systemic Inflammatory Response Syndrome (SIRS) in acutely hospitalised medical patients: a cohort study"

Báo cáo y học: "The Systemic Inflammatory Response Syndrome (SIRS) in acutely hospitalised medical patients: a cohort study"

... Texas, USA) forstatistical analysis.EthicsIn accordance with Danish regulations, the study wasapproved by the Danish Data Protection Agency.ResultsDuring the enrolment period, a total of 643 patients ... length of hospital stay, diagnosis ondischarge, 28 day mortality and, if possible, the course ofmortality. The follow-up registration was made by chartreview by one of the authors...
Ngày tải lên : 25/10/2012, 09:56
  • 6
  • 698
  • 1
 Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"

Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"

... erik.zakariassen@isf.uib.no1National Centre for Emergency Primary Health Care, Uni Health, Bergen,Norway, Kalfarveien 31, 5018 Bergen, NorwayZakariassen et al. Scandinavian Journal of Trauma, Resuscitation ... Acute vital (life threatening) dangerNACA 6 Acute cardiac or respiratory arrestNACA 7 DeathZakariassen et al. Scandinavian Journal of Trauma, Resuscitation and Emergency Medicin...
Ngày tải lên : 25/10/2012, 09:56
  • 9
  • 784
  • 0
Báo cáo y học: "The evolving story of medical emergency teams in quality improvement"

Báo cáo y học: "The evolving story of medical emergency teams in quality improvement"

... story of medical emergency teams in qualityimprovementAndré Carlos Kajdacsy-Balla Amaral1 and Kaveh G Shojania21Department of Critical Care Medicine, Sunnybrook Health Sciences Centre, University ... defined as undesirable outcomes caused bymedical care rather than underlying disease processes, affectapproximately 3% to 12% of hospitalized patients. At least athird, but as many as hal...
Ngày tải lên : 25/10/2012, 10:06
  • 2
  • 427
  • 0

Xem thêm