Báo cáo y học: "omparative Efficacy and Tolerability of 5-Loxin® and Aflapin® Against Osteoarthritis of the Knee: A Double Blind, Randomized, Placebo Controlled Clinical Study"

Báo cáo y học: "omparative Efficacy and Tolerability of 5-Loxin® and Aflapin® Against Osteoarthritis of the Knee: A Double Blind, Randomized, Placebo Controlled Clinical Study"

Báo cáo y học: "omparative Efficacy and Tolerability of 5-Loxin® and Aflapin® Against Osteoarthritis of the Knee: A Double Blind, Randomized, Placebo Controlled Clinical Study"

... Tolerability of 5-Loxin® and Aflapin® Against Osteoarthritis of the Knee: A Double Blind, Randomized, Placebo Controlled Clinical Study Krishanu Sengupta1, Alluri V. Krishnaraju1, Amar A. Vishal2, ... a y , double- blind, randomized, placebo- controlled study was conducted to evaluate the com-parative efficacy and tolerability of 5-Lox...

Ngày tải lên: 25/10/2012, 11:40

12 606 0
Báo cáo y học: "Oral Rehydration Therapy for Preoperative Fluid and Electrolyte Management"

Báo cáo y học: "Oral Rehydration Therapy for Preoperative Fluid and Electrolyte Management"

... grade III of the ASA physical status classification and, basically, was not the patient ap-propriate for the ORT treatment, and it was probable that hyperinflation of the lung was ... Toshio Sasaki2, Hisae Fujita2 1. School of Nutrition & Dietetics, Kanagawa University of Human Services, Yokosuka, Kanagawa 238-8522, Japan 2. Department of Anesthesiology, Kanagawa Canc...

Ngày tải lên: 25/10/2012, 10:51

9 489 0
Báo cáo y học: " Helicobacter pylori induces mitochondrial DNA mutation and reactive oxygen species level in AGS cells"

Báo cáo y học: " Helicobacter pylori induces mitochondrial DNA mutation and reactive oxygen species level in AGS cells"

... (5’→3’) Anticipated length (bp) D-Loop ATTCTAACCTGAATCGGAGG GATGCTTGCATGTGTAATCT 1528 ATPase8 CCCGGACGTCTAAACCAAACC GGGGATCAATAGAGGGGGAAATA 512 ATPase6 AATTACCCCCATACTCCTTACACT GGGTCATGGGCTGGGTTTTACTAT ... GGGTCATGGGCTGGGTTTTACTAT 857 COX-I CCTCGGAGCTGGTAAAAA GGGGGTTCGATTCCTTC 1654 COX-II ACTACCCCGATGCATACACCACA GGGCAATGAATGAAGCGAACAG 1333 COX-III GCCGTACGCCTAACCGCTAACA TCGTAAGGGGTGGTTTTTCTAT...

Ngày tải lên: 25/10/2012, 11:18

12 557 2
 Báo cáo y học: " Carotid Intima-media thickness in childhood and adolescent obesity relations to abdominal obesity, high triglyceride level and insulin resistance"

Báo cáo y học: " Carotid Intima-media thickness in childhood and adolescent obesity relations to abdominal obesity, high triglyceride level and insulin resistance"

... by the direct assay method, alanine aminotransferase (ALT) and aspartate aminotransfe-rase (AST) were tested by enzyme-linked immuno-sorbent assay method. Fasting plasma glucose (FPG) was measured ... for qualitative items by χ2 test and for quantitative items by One-Way ANOVA. Thereafter, associations were examined by Pearson correlation analysis for continuous variables, and by Spea...

Ngày tải lên: 25/10/2012, 11:40

6 478 0
Báo cáo y học: "Maitake Mushroom Extracts Ameliorate Progressive Hypertension and Other Chronic Metabolic Perturbations in Aging Female Rats"

Báo cáo y học: "Maitake Mushroom Extracts Ameliorate Progressive Hypertension and Other Chronic Metabolic Perturbations in Aging Female Rats"

... FAPGG is hydro-lyzed by ACE to furylacryloylphenylalanine (FAP) and glycylglycine. Hydrolysis of FAPGG results in a decreased absorbency at 340 nm. Serum ACE activity was determined by comparing ... at 10 days but a significant lowering of average SBP by day 30 and throughout the re-mainder of the study. The entire BP profile and heart rate were as-sessed near the end...

Ngày tải lên: 26/10/2012, 08:57

12 469 0
 Báo cáo y học: "980 nm diode lasers in oral and facial practice: current state of the science and art"

Báo cáo y học: "980 nm diode lasers in oral and facial practice: current state of the science and art"

... literature on the advantages of the compactness, reliability, ease of use and affordability of the 980 nm Diode Lasers, we evaluated the efficacy and safety of one such Laser for the treatment of pathological ... machines" can replace " ;the brain and hand, skill and experience" of the specialist. The aim of this study was to verify the r...

Ngày tải lên: 26/10/2012, 09:48

7 567 1
Báo cáo y học: "introduction to special issue on Eye and Zoonosis – from the guest editors"

Báo cáo y học: "introduction to special issue on Eye and Zoonosis – from the guest editors"

... on Eye and Zoonosis – from the guest editors Jelka G. ORSONI and Paolo MORA  Inflammatory and Autoimmune Ocular Diseases Service - Institute of Ophthalmology - University of Parma - Italy ... Paolo MORA, Inflammatory and Autoimmune Ocular Diseases Service - Institute of Ophthal-mology - University of Parma – Italy. E-mail: paolo.mora@unipr.it Published: 2009.03.19 Abstract...

Ngày tải lên: 03/11/2012, 11:11

2 617 0
Báo cáo Y học: Baboon cytochrome P450 17a-hydroxylase/17,20-lyase (CYP17) Characterization of the adrenal microsomal and cloned enzymes docx

Báo cáo Y học: Baboon cytochrome P450 17a-hydroxylase/17,20-lyase (CYP17) Characterization of the adrenal microsomal and cloned enzymes docx

... activity of CYP17 and the differential regulation thereof have been the subject of many studies. It is apparent that the normal expression and dual hydroxylase and lyase activities of this key enzyme ... formation of 1 6a- hydroxyprogesterone. Both expressed enzymes had no lyase activity towards PROG or 17-OHPROG. Understanding of the complexity of hydroxylase and...

Ngày tải lên: 08/03/2014, 09:20

9 420 0
Báo cáo Y học: High affinity binding between laminin and laminin binding protein of Leishmania is stimulated by zinc and may involve laminin zinc-finger like sequences doc

Báo cáo Y học: High affinity binding between laminin and laminin binding protein of Leishmania is stimulated by zinc and may involve laminin zinc-finger like sequences doc

... High affinity binding between laminin and laminin binding protein of Leishmania is stimulated by zinc and may involve laminin zinc-finger like sequences Keya Bandyopadhyay, Sudipan Karmakar, Abhijit ... using anti-LBP Ig and secondary antibody also resulted in a 67-kDa band (lane 5) confirming the a uthenticity of the protein. Finally, the parasitic origin of the protein...

Ngày tải lên: 08/03/2014, 23:20

8 420 0
Báo cáo Y học: Cellular stresses profoundly inhibit protein synthesis and modulate the states of phosphorylation of multiple translation factors potx

Báo cáo Y học: Cellular stresses profoundly inhibit protein synthesis and modulate the states of phosphorylation of multiple translation factors potx

... mRNA translation; S6 kinase. The control of mRNA translation in mammalian cells involves the regulation of a range of components of the translational machinery, principally by changes in their phosphorylation, ... branches of this pathway [19]. p70 S6k is activated by insulin and growth factors (reviewed in [20]) and appears to play a role in up-regulating the transl...

Ngày tải lên: 18/03/2014, 01:20

10 444 0
w