Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc
... autoradio- graphy. In vitro transcription, translation, targeting and cross-linking analysis To generate truncated mRNA, plasmids (Table 1) encoding truncated nascent chains were linearized and transcribed ... translocon [5,6]. At the onset of translocation, SecB is released [7] and the preprotein is translocated by an insertion–deinsertion cycle of SecA into the SecYEG translocon...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo Y học: The reactivity of a-hydroxyhaem and verdohaem bound to haem oxygenase-1 to dioxygen and sodium dithionite pdf
... formation of a- hydroxyhaem with haem oxygenase may be small and a substantial amount of free a- hydroxyhaem may remain, depending on the reconstitution conditions; this could lead to a misinterpretation ... the precipitation of free a- hydroxyhaem. These observations indicated that a- hydroxyhaem might be apt to aggregate during incubation at neutral pH, and consequently,...
Ngày tải lên: 23/03/2014, 21:20
Báo cáo y học: "The epidemiology of medical emergency contacts outside hospitals in Norway - a prospective population based study"
Ngày tải lên: 25/10/2012, 09:56
Báo cáo y học: "The characterisation of mucin in a mature ovarian teratoma occurring in an eight year old patient
Ngày tải lên: 26/10/2012, 10:03
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf
... Further identification and quantification of puromycin were achieved by a Pac enzymatic assay [21]. Preparation of 3¢-amino-3¢-deoxyadenosine 3¢-amino-3¢-deoxyadenosine was obtained from Helmin- thosporium ... letters. The start and direction of each ORF are indicated by horizontal arrows and named accordingly. Putative )10 and )35 regions of ata12 and ataPKS1 are overlined....
Ngày tải lên: 21/02/2014, 01:21
Báo cáo Y học: The mechanism of nitrogen monoxide (NO)-mediated iron mobilization from cells NO intercepts iron before incorporation into ferritin and indirectly mobilizes iron from ferritin in a glutathione-dependent manner pot
... the pyridoxal isonicotinoyl hydrazone class as effective antiproliferative agents II. The mechanism of action of ligands derived from salicylaldehyde benzoyl hydrazone and 2-hydroxy-1-naphthylaldehyde ... a plastic spatula to detach them. Radioactivity was measured in both the cell pellet and supernatant using a c-scintillation counter (LKB Wallace 1282 Compugamma, Finland). Dete...
Ngày tải lên: 08/03/2014, 22:20
Báo cáo Y học: The role of the second binding loop of the cysteine protease inhibitor, cystatin A (stefin A), in stabilizing complexes with target proteases is exerted predominantly by Leu73 pdf
... CTTGCATGCCCTGCAGGTCG Mutagenic L73G Forward GTATTCAAAAGTGGTCCCGGACAAAATGAG GACTTG Reverse TCCGGGACCACTTTTGAATACTTTCAAGTGCATATATTTATT P74G Forward CAAAAGTCTTGGCGGACAAAATGAGGACTTGGTAC Reverse CATTTTGTCCGCCAAGACTTTTGAATACTT ... function as the second binding loops of cystatin B and family 2 cystatins and also what residues of this loop in cystatin A may participate in the interacti...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo Y học: The presence of phosphate at a catalytic site suppresses the formation of the MgADP-inhibited form of F1-ATPase potx
... mitoch ondrial F 1 -ATPase and inhibits catalysis is bound at a catalytic site. Biochim. Biophys. Acta 1020, 43±48. 11. Muneyuki, E., Makino, M., Kamata, H., K agawa, Y ., Y oshida, M. & Hirata, ... Masasuke Yoshida Chemical Resources Laboratory, Tokyo Institute of Technology, Japan F 1 -ATPase i s inactivated by entrapment of MgADP in catalytic sites and reactivated by Mg...
Ngày tải lên: 24/03/2014, 00:21
Báo cáo Y học: Identification of a critical lysine residue at the active site in glyceraldehyde-3-phosphate dehydrogenase of Ehrlich ascites carcinoma cell ppt
... concentration of the reagent. Table 1. Inactivation of Gra3P DH of EAC cells and rabbit muscle by TNBS or PP and reactivation of the enzymes by thiol-containing compounds. Approximately 5 U of the EAC ... modification of a unique lysine residue of EAC cell Gra3P DH and of a cysteine residue of rabbit muscle Gra3P DH. Protection of the activity of EAC cell Gra3 P...
Ngày tải lên: 24/03/2014, 04:21