Báo cáo y học: "Spinal Intramedullary Cysticercosis: A Case Report and Literature Review"
Báo cáo y học: "Spinal Intramedullary Cysticercosis: A Case Report and Literature Review"
... 420 IInntteerrnnaattiioonnaall JJoouurrnnaall ooff MMeeddiiccaall SScciieenncceess 2011; 8(5):420-423 Case Report Spinal Intramedullary Cysticercosis: A Case Report and Literature Review Bin ... subdural, arachnoid, or intramedullary) , of which the intramedullary type is quite rare and only fifty-three cases have been reported until 20101-3,8,13. Here, we reported a case of intramedullary ... intramedullary cysticer-cosis at T4 and T5 vertebral level and discussed its diagnosis and treatment with literature review. Case Report A 40-year-old female patient was transferred...
- 4
- 592
- 0
Báo cáo y học: "Do we need a critical care ultrasound certification program? Implications from an Australian medical-legal perspective"
... care is reasonable skills and care reasonably expected of a practitioner with the same standing. e standard of care is diff erent in cases of diagnosis and treatment, and in cases of giving advice ... competency of healthcare pro-viders and the provision of a reasonable standard of healthcare service are inter-related, and the failure of either one has not only legal but also cost and psycho-logical ... provided by a single profes sional body that is well-recognized and widely accepted in Australia and New Zealand, the Australasian Society of Ultrasound in Medicine.ConclusionMedical practitioners...
- 6
- 714
- 0
Báo cáo y học: "The Impact of a Nationwide Antibiotic Restriction Program on Antibiotic Usage and Resistance against Nosocomial Pathogens in Turkey"
... Resistance against Nosocomial Pathogens in Turkey Adalet Altunsoy1, Cenk Aypak2, Alpay Azap1, Önder Ergönül3, İsmail Balık1 1. Department of Clinical Microbiology and Infectious Disease, Ankara ... antimicrobial resistance, and cost. Materials and Methods: The data obtained from all of the four university hospitals, and one referral tertiary-care educational state hospital in Ankara. Antimicrobial ... total weight (gram) and number of boxes were calculated from two databases, 1) Hospital pharmacy computer data-bases, and 2) International Medication System (IMS). Because Turkey is an...
- 6
- 692
- 0
Báo cáo y học: "Foramen Magnum Arachnoid Cyst Induces Compression of the Spinal Cord and Syringomyelia: Case Report and Literature Review"
... su-pratentorial ventricular system was normal (Figure 1). Based on history and physical and MRI examinations, we diagnosed the lesion as a foramen magnum arachnoid cyst with syringomyelia. ... magnum arachnoid cyst directly compresses the spi-nal cord and develops syringomyelia. Here we re-ported a rare case of foramen magnum arachnoid cyst with occupying only small area ... Tachibana S, Harada K, Abe T, et al. Syringomyelia secondary to tonsillar herniation caused by posterior fossa tumors. Surg Neurol. 1995;43:470-475. 9. Kasliwal MK, Suri A, Sharma BS. Dandy...
- 6
- 656
- 0
Báo cáo y học: " Laugh Yourself into a Healthier Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health"
... Person: A Cross Cultural Analysis of the Effects of Varying Levels of Laughter on Health Hunaid Hasan, Tasneem Fatema Hasan Mahatma Gandhi Mission’s Medical College, Aurangabad, Maharastra, India, ... Journal of Personality and Social Psychology. 1998; 74: 482–93. Author biography Hunaid Hasan is a final year medical student at Mahatma Gandhi Mission’s Medical Col-lege-Maharashtra University ... to: Hunaid Hasan or Tasneem Fatema Hasan, “Ezzi Manzil”, CTS No. 3910, Near Bombay Mercantile Bank, Beside Amodi Complex, City Chowk, Juna Bazaar, Aurangabad, Maharashtra, India 431001. Email:...
- 12
- 757
- 0
Tài liệu Báo cáo Y học: Identification of a set of genes involved in the biosynthesis of the aminonucleoside moiety of antibiotic A201A from Streptomyces capreolus pdf
... complementa-tion assays. The ataP5, ataP4 and ataP10 genes were alsoindependently inserted in the pIJ702 vector and the resultingplasmids pA 2A5 , pA 2A4 and pA 2A1 0, respectively(Materials and methods), ... similarities with several products from the purcluster of S. alboniger [6]. They were accordingly namedataP3, ataP5, ataP4, ataP10 and ataP7. The two additionalones were named ata12 and ataPKS1 ... moiety of A2 0 1A and puromycin by S. capreolus and S. alboniger, respectively.Considering that most, if not all, of the genes betweenard1 and ard2 are part of the ata cluster, ata12 and ataPKS1should...
- 9
- 728
- 0
Tài liệu Báo cáo Y học: CK2btes gene encodes a testis-specific isoform of the regulatory subunit of casein kinase 2 in Drosophila melanogaster potx
... the regulatorysubunit of casein kinase 2 inDrosophila melanogasterAlla I. Kalmykova1, Yuri Y. Shevelyov1, Oksana O. Polesskaya1,*, Anna A. Dobritsa1,†,Alexandra G. Evstafieva2, Brigitte ... quantitative and qualitative assays for b-galactosidase (activation of LacZ reporter gene). BD, pGBT9; BD*, pAS2-1; AD, pGAD424;AD**, pACT2. Activity values are given as mean values ± standard ... protein -A Sepharose,washed and separated by SDS/PAGE. The immunostainingof Western blot was performed by commercially available,high affinity anti-(b-galactosidase) Ig.Anti-(b-galactosidase)...
- 10
- 464
- 0
Tài liệu Báo cáo Y học: Functional analysis of a small heat shock/a-crystallin protein from Artemia franciscana docx
... franciscanaOligomerization and thermotoleranceJulie A. Crack, Marc Mansour, Yu Sun and Thomas H. MacRaeDepartment of Biology, Dalhousie University, Halifax, Nova Scotia, CanadaOviparously ... from Artemia cysts[57], and molecular mass markers o f 29 kDa (carbonicanhydrase), 66 k Da (bovine serum albumin), 150 kDa(alcohol dehydrogenase), 200 kDa (a- amylase), 443 kDa(apoferritin), and ... Xho-as) CGCGCCTCGAGTTATGGAGTTGAACTAGCTGTp26-alpha 1–60 and (p26-60Bam-s) GCGCGGATCCACCATGTCCTTGAGGGACACA 297/93153–192 (p26-153Xho-as) CGCGCCTCGAGTTAACGTTCTGTTGGTGAGCT934 J. A. Crack et al.(Eur....
- 10
- 495
- 0
Tài liệu Báo cáo Y học: Divergent members of a soybean (Glycine max L.) 4-coumarate:coenzyme A ligase gene family potx
... biosynthetic pathways. This idea wassubstantiated by the observation that isoenzymes of 4CLin soybean (Glycine max), petunia ( Petunia hybrida), pea(Pisum sativum), oat ( Avena sativa), and ... 5¢-TCYGGRTCRTTNAGRTADCCTTTCAT-3¢4CL1-S2 5¢-TBACNCARTCNGCNTAYGTBGARAA-3¢4CL3-HindIII 5¢-GTTCTAAGCTTTTAAGGCGTCTGAGTGGC-3¢4CL13–3¢KpnI5¢-AGTTTCAGGGTCAACAACCCTG-3¢4CL13-EcoRI 5¢-CTCGAATTCATGACAACGGTAGCTGCTTCTC-3¢4CL14-BamHI ... 5¢-TGTTCCGGAGAGCCTCCTC-3¢4CL16-GSP2 5¢-CAACGGAAGCACGCATAGGAGCAC-3¢4CL16-SphI5¢-CACCGCATGCATAACTCTAGCTCCTTCTCTTG-3¢Seq1 5¢-GTAAAACGACGGCCAGT-3¢1306 C. Lindermayr et al. (Eur. J. Biochem. 269) Ó FEBS 2002Hybridization conditions...
- 12
- 448
- 0
Báo cáo Y học: The presence of a helix breaker in the hydrophobic core of signal sequences of secretory proteins prevents recognition by the signal-recognition particle in Escherichia coli doc
... replaced byPCR fragments created using the PhoE forward primer(5¢-GCCGGAATTCTAATATGAAAAAGAGCACTCTGGC-3¢) and the 94PhoE reverse primer (5¢-CGCGGATCCTTTTTGCTGTCAGTATCAC-3¢), pNN7 and pNN8as ... PhoE-specific anti-serum [31] by SDS/PAGE [32] and visualized by autoradio-graphy.In vitrotranscription, translation, targeting and cross-linking analysisTo generate truncated mRNA, plasmids (Table ... directed against P48 and TF, analyzed on SDS/PAGE and visualized with a PhosphorImager. (B) Quantification ofdata presented in panel (A) , after correction for translation efficiency.The highest amounts...
- 8
- 546
- 0
Từ khóa: báo cáo y họcbáo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngNghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Định tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXBT Tieng anh 6 UNIT 2chuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘITÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ