Báo cáo y học: " Introduction of Medical Emergency Teams in Australia and New Zealand: a multi-centre study"

Báo cáo y học: " Introduction of Medical Emergency Teams in Australia and New Zealand: a multi-centre study"

Báo cáo y học: " Introduction of Medical Emergency Teams in Australia and New Zealand: a multi-centre study"

... incidence of in- hospital CAs in anumber of single-centre before -and- after studies [5-9]. AANZ = Australia and New Zealand; ANZICS = Australian and New Zealand Intensive Care Society; ANZICS-APD ... = Australian and New Zealand Intensive Care Society Adult Patient Database; APD = Adult Patient Database; ARCCCR = Australian and New Zealand Intensive Care Society Re...

Ngày tải lên: 25/10/2012, 10:35

8 640 0
Báo cáo Y học: Expression of uncoupling protein-3 in subsarcolemmal and intermyofibrillar mitochondria of various mouse muscle types and its modulation by fasting docx

Báo cáo Y học: Expression of uncoupling protein-3 in subsarcolemmal and intermyofibrillar mitochondria of various mouse muscle types and its modulation by fasting docx

... Patrick Keller, Aaron Russell, Franc¸oise Kuhne, Pierre Flandin, Jean-Paul Giacobino and Patrick Muzzin Department of Medical Biochemistry, Faculty of Medicine, University of Geneva, Switzerland Uncoupling ... or human UCP3. Figure 2A shows that the UCP3 signal of human recombinant protein interacting with the antibody to human UCP3 increases linearly as a function of increas...

Ngày tải lên: 24/03/2014, 04:21

7 535 0
Báo cáo y học: "Management of chest pain: exploring the views and experiences of chiropractors and medical practitioners in a focus group interview"

Báo cáo y học: "Management of chest pain: exploring the views and experiences of chiropractors and medical practitioners in a focus group interview"

... episodes of unexplainedretrosternal pain in patients lacking a cardiac abnormalityafter a reasonable evaluation, is associated with repeatedemergency room utilization [73] and may be treatedempirically ... equiva-lent to medical residencies in family practice. They usuallyrequire approximately 360 additional hours of didactictraining, with only part of that training in...

Ngày tải lên: 25/10/2012, 10:06

10 789 0
Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"

Báo cáo y học: "Utility of routine chest radiographs in a medical–surgical intensive care unit: a quality assurance survey"

... surveyNatalie Chahine-Malus, Thomas Stewart, Stephen E Lapinsky, Ted Marras, David Dancey, Richard Leung and Sangeeta MehtaMount Sinai Hospital, Toronto, Ontario, CanadaCorrespondence: S Mehta, ... prospectivelyevaluate their utility in our medical surgical ICU as part of aquality assurance survey. The goals of this study were todetermine the percentage of routine and non-routi...

Ngày tải lên: 25/10/2012, 10:45

5 507 0
Báo cáo y học: "Prevalence of Overactive Bladder, its Under-Diagnosis, and Risk Factors in a Male Urologic Veterans Population"

Báo cáo y học: "Prevalence of Overactive Bladder, its Under-Diagnosis, and Risk Factors in a Male Urologic Veterans Population"

... Borawski1, William Tran1, Martin H Bluth2 1. SUNY Downstate Medical School, Department of Urology, Brooklyn, NY, USA 2. Wayne State University School of Medicine, Department of Pathology , ... there was a statistically signif-icant association between OAB and hepatitis (p=0.03, OR=2.2). See Table 3. Table 2. Prevalence of OAB, LUTS and OAB subtypes. DISCUSSION The prevalence...

Ngày tải lên: 25/10/2012, 11:35

4 522 0
 Báo cáo y học: "Replacement of cisplatin with nedaplatin in a definitive 5-fluorouracil/ cisplatin-based chemoradiotherapy in Japanese patients with esophageal squamous cell carcinoma"

Báo cáo y học: "Replacement of cisplatin with nedaplatin in a definitive 5-fluorouracil/ cisplatin-based chemoradiotherapy in Japanese patients with esophageal squamous cell carcinoma"

... Nakamura 3, Kazusaburo Kataoka 1 and Toshiyuki Sakaeda 2,3  1. School of Pharmacy and Pharmaceutical Sciences, Mukogawa Women’s University, Nishinomiya, Japan; 2. Graduate School of Pharmaceutical ... toxicity of nedaplatin and 5-FU with radiation treatment for advanced esophageal carcinomas. Anticancer Res. 2003; 23: 3493-8. 15. Yamada H, Maki H, Takeda Y, et al. Evaluation of...

Ngày tải lên: 26/10/2012, 09:53

7 531 0
Báo cáo y học: " Role of Dietary Soy Protein in Obesity"

Báo cáo y học: " Role of Dietary Soy Protein in Obesity"

... en-ergy as fat and 28% as protein); and carbohydrate diet (28% of energy as fat and 11% as protein) and were administered for 4 days in a 3-way crossover design. After 4 days of each dietary intervention, ... plasma levels of alanine transaminase and aspartate transaminase [55]. These effects were accompanied by increased activities of mitochondrial and peroxisomal bet...

Ngày tải lên: 31/10/2012, 14:59

11 670 2
Báo cáo y học: "Treatment of Chronic HCV Infection in Special Populations."

Báo cáo y học: "Treatment of Chronic HCV Infection in Special Populations."

... reduction in viral RNA was seen to be less in African Americans than Caucasians by 50%. This indicates a larger population of slow responders in African Americans which may explain a low SVR in this ... hydrostatic balance into the peritoneal cavity and the use of the serum to ascites albumin gradient (SAAG) in the differential diagnosis of ascites. Much of his researc...

Ngày tải lên: 02/11/2012, 09:48

6 389 0
Tài liệu Báo cáo Y học: Control of p70 ribosomal protein S6 kinase and acetyl-CoA carboxylase by AMP-activated protein kinase and protein phosphatases in isolated hepatocytes pot

Tài liệu Báo cáo Y học: Control of p70 ribosomal protein S6 kinase and acetyl-CoA carboxylase by AMP-activated protein kinase and protein phosphatases in isolated hepatocytes pot

... between 5 and 10 min of incubation. In contrast, the inactivation of p70S6K by AICAr was slower and was half-maximal only at 7 min, whereas the inactiva- tion of ACC by AICAr was half-maximal at about ... glutamine and leucine, induce an anabolic response in liver. They activate p70 riboso- mal protein S6 kinase (p70S6K) and acetyl-CoA car- boxylase (ACC) involved in prote...

Ngày tải lên: 22/02/2014, 07:20

9 455 0
Báo cáo Y học: Regulation of a1,3galactosyltransferase expression in pig endothelial cells Implications for xenotransplantation doc

Báo cáo Y học: Regulation of a1,3galactosyltransferase expression in pig endothelial cells Implications for xenotransplantation doc

... a1 ,3GalT-5¢ -A p12 CCTGTCAAAAGAATAAACAGCGGTT Exon 3 a1 ,3GalT-5¢ -A p13 CACTGTTCCCTCAGCCGAGGAC Exon 1 a1 ,3GalT-5¢-B and -E p14 CCAACTCCTGATCGGCAGAAGC Exon 1 a1 ,3GalT-5¢B and E p15 ACTTCTGAAGCCTAAAGGATGCGA ... ACTTCTGAAGCCTAAAGGATGCGA Exon 2 a1 ,3GalT-5¢-C p16 AGGCAGGGCTGGGAGGAA Exon 3 a1 ,3GalT-5¢-C p17 TTGCTGTCGGAAGATACATTGAG Exon 8 a1 ,3GalT-coding region p18 CTTTGTGGCCAACCA...

Ngày tải lên: 08/03/2014, 16:20

10 444 0
w