Báo cáo y học: " A retrospective quality assessment of pre-hospital emergency medical documentation in motor vehicle accidents in south-eastern Norway"
Báo cáo y học: " A retrospective quality assessment of pre-hospital emergency medical documentation in motor vehicle accidents in south-eastern Norway"
... this article as: Staff and Søvik: A retrospective quality assessment ofpre-hospital emergency medical documentation in motor vehicleaccidents in south-eastern Norway. Scandinavian Journal of Trauma,Resuscitation ... ORIGINAL RESEARCH Open AccessA retrospective quality assessment of pre-hospitalemergency medical documentation in motorvehicle accidents i...
Ngày tải lên: 25/10/2012, 09:56
Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"
... Gornik*1, Ana Vujaklija-Brajković1, Ivana PavlićRenar2 and Vladimir Gašparović1AbstractIntroduction: Critical illness is commonly complicated by hyperglycaemia caused by mediators of stress and inflammation. ... if insulin wasadministered for treatment of hyperglycaemia. Venousblood was analyzed on a point -of- care blood gas analyzer(IL GEM® Premier™ 3000, Instrumentation Laboratories,...
Ngày tải lên: 25/10/2012, 10:02
Báo cáo y học: "A three-country comparison of psychotropic medication prevalence in youth"
... School of Pharmacy, University of Maryland, Baltimore, Maryland, USA, 2Department of Psychiatry, School of Medicine, University of Maryland, Baltimore, Maryland, USA, 3Departments of Psychiatry and ... amphetamineproducts. Anticonvulsant-mood stabilizers (ATC-MS)included carbamazepine, divalproex/valproic acid, lamo-trigine, gabapentin and topiramate. Cross-national com-parisons...
Ngày tải lên: 25/10/2012, 10:06
Báo cáo y học: "A Comparative Effectiveness Study of Bone Density Changes in Women Over 40 Following Three Bone Health Plans Containing Variations of the Same Novel Plant-sourced Calcium"
... physical activity and health literacy. Each group completed the same baseline and ending DXA bone density scans, 43-chemistry blood test panels, and 84-item Quality of Life Inventory (QOL). Changes ... The pri-mary outcome measure was changes in baseline BMD (Bone Mineral Density) among participants with above average compliance in order to examine the safety and efficacy in people...
Ngày tải lên: 25/10/2012, 11:10
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
... years). None of the NT subjects had a family history of hypertension; all had an SBP less than 130 mmHg and a DBP less than 85 mmHg. A family history of hypertension was defined as having grandparents, ... Sequencing analysis Two oligonucleotides (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’- CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were...
Ngày tải lên: 26/10/2012, 10:04
Báo cáo Y học: A functionally conserved member of the FTZ-F1 nuclear receptor family from Schistosoma mansoni doc
... DNA binding and tran- scriptional activation in transfected cell lines. MATERIALS AND METHODS Parasites A Puerto-Rican strain of S. mansoni was maintained in Biomphalaria glabrata snails and golden ... specificity as mammalian SF-1. Moreover, it can transactivate transcription of a reporter gene in mammalian cell lines. This demonstrates that it can interact with mammalian coacti...
Ngày tải lên: 23/03/2014, 21:20
Báo cáo Y học: A model for recognition of polychlorinated dibenzo-p-dioxins by the aryl hydrocarbon receptor docx
... ligands; in FixL, oxygen binding at the heme binding PAS domain controls the activity of a h istidine kinase domain [12]; and in PYP, a local conformational change occurs once the p-hydroxycinnamoyl ... encompassing two imperfect repeats of 110 amino acids ( PAS -A and PAS-B) separated by a sequence of 50 amino acids. A minimal LBD was mapped in the mouse AhR (mAhR) b...
Ngày tải lên: 24/03/2014, 00:21
Báo cáo Y học: A nonphosphorylated 14-3-3 binding motif on exoenzyme S that is functional in vivo pot
... G-protein Ras – as a readout [35]. Secondly, we employed a cytotoxicity assay, since the ADP- ribosylation activity of ExoS mediates a marked change in cell morphology and has a lethal activity upon ... question can be approached by using an in vitro Ras modification assay, where ADP-ribosylation of Ras by ExoS is reflected by a gel mobility shift of Ras on SDS/PAGE [35]. In...
Ngày tải lên: 31/03/2014, 08:20
Báo cáo Y học: A new conceptual framework for enzyme catalysis Hydrogen tunneling coupled to enzyme dynamics in flavoprotein and quinoprotein enzymes docx
... breakage in three different substrates by Alcaligenes faecalis AADH [39], the fast substrates dopam- ine and tryptamine, and the slow substrate benzylamine. Again,aswithMADHandTSOX,anindicationasto ... tryptophan tryptophyl- quinone (TTQ)-dependent amine oxidases methylamine dehydrogenase (MADH) and aromatic amine dehydroge- nase (AADH), and also the flavoenzymes trimethylamine dehydrogenase...
Ngày tải lên: 31/03/2014, 23:20
Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"
... Atrio-Ventricular Nodal Reentry Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; INR: International Normalized Ratio; ... prior to ablation for AVNRT-, AVRT-and EAT patients. Panel A: Quantity and duration of episodes and the associated symptoms. Panel B: Detraction in daily life generally and in parts of d...
Ngày tải lên: 03/11/2012, 11:44