Báo cáo y học: " A retrospective quality assessment of pre-hospital emergency medical documentation in motor vehicle accidents in south-eastern Norway"
Báo cáo y học: " A retrospective quality assessment of pre-hospital emergency medical documentation in motor vehicle accidents in south-eastern Norway"
... this article as: Staff and Søvik: A retrospective quality assessment ofpre-hospital emergency medical documentation in motor vehicleaccidents in south-eastern Norway. Scandinavian Journal of Trauma,Resuscitation ... ORIGINAL RESEARCH Open AccessA retrospective quality assessment of pre-hospitalemergency medical documentation in motorvehicle accidents in south-eastern NorwayTrine Staff1,2,4*and Signe Søvik3AbstractBackground: ... Norwegian Air Ambulance Foundation, Drøbak,NorwayFull list of author information is available at the end of the articleStaff and Søvik Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine...
- 11
- 705
- 1
Báo cáo y học: "A prospective observational study of the relationship of critical illness associated hyperglycaemia in medical ICU patients and subsequent development of type 2 diabetes"
... Gornik*1, Ana Vujaklija-Brajković1, Ivana PavlićRenar2 and Vladimir Gašparović1AbstractIntroduction: Critical illness is commonly complicated by hyperglycaemia caused by mediators of stress and inflammation. ... if insulin wasadministered for treatment of hyperglycaemia. Venousblood was analyzed on a point -of- care blood gas analyzer(IL GEM® Premier™ 3000, Instrumentation Laboratories,Lexington, MA, USA). ... according to theACC/AHA criteria [26,27]Statistical analysesMedCalc™ v. 9.6.2.0 (MedCalc Software, Mariakerke, Bel-gium). statistical software was used for all statistical anal-yses. Categorical data...
- 8
- 656
- 1
Báo cáo y học: "A three-country comparison of psychotropic medication prevalence in youth"
... School of Pharmacy, University of Maryland, Baltimore, Maryland, USA, 2Department of Psychiatry, School of Medicine, University of Maryland, Baltimore, Maryland, USA, 3Departments of Psychiatry and ... amphetamineproducts. Anticonvulsant-mood stabilizers (ATC-MS)included carbamazepine, divalproex/valproic acid, lamo-trigine, gabapentin and topiramate. Cross-national com-parisons of any psychotropic medication ... study aims to compare cross-national prevalence of psychotropic medication use in youth.Methods: A population-based analysis of psychotropic medication use based on administrative claims data forthe...
- 8
- 488
- 1
Báo cáo y học: "A Comparative Effectiveness Study of Bone Density Changes in Women Over 40 Following Three Bone Health Plans Containing Variations of the Same Novel Plant-sourced Calcium"
... physical activity and health literacy. Each group completed the same baseline and ending DXA bone density scans, 43-chemistry blood test panels, and 84-item Quality of Life Inventory (QOL). Changes ... The pri-mary outcome measure was changes in baseline BMD (Bone Mineral Density) among participants with above average compliance in order to examine the safety and efficacy in people ... Stryer DG, Clancy CM: Practical clinical trials: in- creasing the value of clinical research for decision making in clinical and health policy. JAMA. 2003; 290:1624– 1632. 39. Avorn...
- 12
- 663
- 0
Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"
... years). None of the NT subjects had a family history of hypertension; all had an SBP less than 130 mmHg and a DBP less than 85 mmHg. A family history of hypertension was defined as having grandparents, ... Sequencing analysis Two oligonucleotides (sense, 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’- CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a ... ventricular hypertrophy in the Japanese. Circ Res. 2000; 86: 841-5. 13. Nakayama T, Soma M, Rahmutula D, Ozawa Y, Kanmatsuse K. Isolation of the 5'-flanking region of genes by thermal asymmet-ric...
- 7
- 612
- 1
Báo cáo Y học: A functionally conserved member of the FTZ-F1 nuclear receptor family from Schistosoma mansoni doc
... DNA binding and tran-scriptional activation in transfected cell lines.MATERIALS AND METHODSParasites A Puerto-Rican strain of S. mansoni was maintained in Biomphalaria glabrata snails and golden ... specificity as mammalian SF-1.Moreover, it can transactivate transcription of a reportergene in mammalian cell lines. This demonstrates that it caninteract with mammalian coactivators of transcription ... This indicates that at least some of themammalian coactivators are capable of interacting withSmFTZ-F1, most probably through its conserved AF2domain. This in turn implies that similar cofactors...
- 12
- 541
- 0
Báo cáo Y học: A model for recognition of polychlorinated dibenzo-p-dioxins by the aryl hydrocarbon receptor docx
... ligands; in FixL, oxygen binding at the hemebinding PAS domain controls the activity of a h istidinekinase domain [12]; and in PYP, a local conformationalchange occurs once the p-hydroxycinnamoyl ... encompassing two imperfect repeats of 110 aminoacids ( PAS -A and PAS-B) separated by a sequence of 50amino acids. A minimal LBD was mapped in the mouseAhR (mAhR) between amino acids 230 and ... FanelliÕ, Universita'di Roma ÔLa SapienzaÕ, Roma, ItalyLigand binding by the aryl hydrocarbon receptor (AhR), a member of the bHLH-PAS family of transcriptional reg-ulatory proteins, has...
- 6
- 569
- 0
Báo cáo Y học: A nonphosphorylated 14-3-3 binding motif on exoenzyme S that is functional in vivo pot
... G-protein Ras – as a readout [35].Secondly, we employed a cytotoxicity assay, since the ADP-ribosylation activity of ExoS mediates a marked change in cell morphology and has a lethal activity upon ... question can be approached by using an in vitro Ras modification assay, where ADP-ribosylation of Ras by ExoS is reflected by a gel mobility shift of Ras onSDS/PAGE [35]. Incubation of Ha-Ras, 14-3-3, ... primer pair pexoSa (forward):5¢-CGGAGAAACTCGAGGAGAAGGCAACCATC-3¢,pexoSb (reverse): 5¢-GTCTTTCTGGTACCACCGGTCAGGCCAGA-3¢. pMF419 and pMF420 were obtained byreplacing the C-terminal ClaI/KpnI fragment...
- 9
- 394
- 0
Báo cáo Y học: A new conceptual framework for enzyme catalysis Hydrogen tunneling coupled to enzyme dynamics in flavoprotein and quinoprotein enzymes docx
... breakage in three different substrates byAlcaligenes faecalis AADH [39], the fast substrates dopam-ine and tryptamine, and the slow substrate benzylamine.Again,aswithMADHandTSOX,anindicationasto ... tryptophan tryptophyl-quinone (TTQ)-dependent amine oxidases methylaminedehydrogenase (MADH) and aromatic amine dehydroge-nase (AADH), and also the flavoenzymes trimethylaminedehydrogenase ... nss4@le.ac.ukAbbreviations:TST,transitionstatetheory;TTQ,tryptophantrypto-phylquinone; MADH, methylamine dehydrogenase; AADH, aroma-tic amine dehydrogenase; TMADH, trimethylamine dehydrogenase;TSOX, heterotetrameric sarcosine dehydrogenase;...
- 7
- 359
- 0
Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"
... Atrio-Ventricular Nodal Reentry Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; INR: International Normalized Ratio; ... prior to ablation for AVNRT-, AVRT-and EAT patients. Panel A: Quantity and duration of episodes and the associated symptoms. Panel B: Detraction in daily life generally and in parts of daily life. ... Lau CP, Tai YT, Lee PW. The effects of radiofrequency ablation versus medical therapy on the quality- of- life and exercise ca-pacity in patients with accessory pathway-mediated supraven-tricular...
- 9
- 679
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonbiểu mẫu báo cáo y tế trường họcbáo cáo y tế học đường trường tiểu họcbáo cáo y tế trường tiểu họcbáo cáo y tế trường học năm 2012Báo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲ