Physicochemical properties of polluted water of river Ganga at Varanasi
... Environment Foundation. All rights reserved. Physicochemical properties of polluted water of river Ganga at Varanasi Singh Namrata Department of Zoology, HarishChandra post Graduate College, Varanasi, ... impact of seasonal changes on the physiochemical properties of water of river Ganga at six selected sampling sites i.e. Assi Ghat, Shiwala Ghat, Chauki...
Ngày tải lên: 05/09/2013, 16:11
... concentration in treated water, however, fluctuated rather small to the daily fluctuation. Pattern of T-N fluctuation in river water was similar to that of BOD, but not for that in treated water. There ... both river and treated water followed the pattern of BOD in river water. NH 4 -N, NO 2 -N and NO 3 -N in river water followed the pattern of T-N, but those in treat...
Ngày tải lên: 05/09/2013, 08:40
... self-purification ability of Cau River. 3.2 Modeling water quality of Cau River by QUAL2E The Enhanced Stream Water Quality Model (QUAL2E) is a comprehensive and versatile stream water quality ... pollution, river water quality is showing signs of pollution at some degrees. For the season, it is necessary to assessing and monitoring river water quality, then usin...
Ngày tải lên: 05/03/2014, 10:20
Báo cáo "Development of cooperative research on assessment of climate change impacts on water resources of Vietnam-China transboundary river basins " doc
... development of Vietnam and China. The main upstream rivers of Hong River system, include: Ly Tien (upstream of Da River) , Nguyen River (upstream of Thao river ) and Ban Long river (upstream of Lo river) ... large daily water level fluctuation which is contrast to natural law: daily water fluctuation is around 1.5-2.0m on Da river at Muong Te, 0.5-1.0m at N...
Ngày tải lên: 05/03/2014, 16:20
Báo cáo khoa học: Physicochemical properties and distinct DNA binding capacity of the repressor of temperate Staphylococcus aureus phage /11 doc
... p Bottom O1 O2 O2 cl O3 O2 cro O1 O1 +–– –140 5'CATTTTCTTACCTCCTTAAATTTACCTATAGTATAACCCAATTATTTTTGGTATTCA GTAAAAGAATGGAGGAATTTAAATGGATATCATATTGGGTTAATAAAAACCATAAGT ACAAAAAAATACACGAAAAGCAAACTTTTATGTTGACTCAAGTACACGTATCGTGTAT TGTTTTTTTATGTGCTTTTCGTTTGAAAATACAACTGAGTTCATGTGCATAGCACATA AGTAGGTTTTGTAAGCGGGAGGTGACAACATG TCATCCAAAACATTCGCCCTCCACTGTTGTAC ... unbound state. The maxi- mum amount o...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo "A study of waste water impacts of main factories on water quality of To Lich river, Ha Noi " doc
... Lich river. 3.3. The influence of pollutants loads in factory waste water on water quality of To Lich river To assess the pollutants load in factory waste water to water quality of the river ... waste water of factories. So, factories impact the water quality of the To Lich River. From the factory waste water analysis it is found that, the main pollutant...
Ngày tải lên: 14/03/2014, 15:20
Simulation of Ground-Water Flow and Evaluation of Water-Management Alternatives in the Assabet River Basin, Eastern Massachusetts pptx
... Survey Water- Resources Investigations Report 93-4121, 45 p. 2 Simulation of Ground -Water Flow and Evaluation of Water- Management Alternatives in the Assabet River Basin, Eastern MA Simulation-optimization ... Department of Conservation and Recreation Scientific Investigations Report 2004-5114 U.S. Department of the Interior U.S. Geological Survey 12 Simulation of Ground -W...
Ngày tải lên: 17/03/2014, 15:20
Tình hình nước bị ô nhiễm arsenic ở trên thế giới (The situation of polluted arsenic water in the world) pdf
Ngày tải lên: 25/03/2014, 05:20
Influence of the support on the physicochemical properties of Pt electrocatalysts: Comparison of catalysts supported on different carbon materials
... supports inthe preparation of electrocatalysts. The use ofthese non-conventional carbon mate- rials as support allows studying the influence of carbon properties on the preparation of catalysts. Carbon ... support. Results proved that the support has a strong influence on the physicochemical properties of catalysts. These properties depended on the nature of the support and ar...
Ngày tải lên: 23/04/2014, 22:47