Power generation from wind turbines in a solar chimney
Power generation from wind turbines in a solar chimney
... that shrouded wind turbines can generate greater power compared to bare turbines. A solar chimney generates an upward draft of wind inside a tower and a shroud around the wind turbine. There are ... Betz's limit; Solar chimney. 1. Introduction In past several years, several studies have shown that the shrouded wind turbines can generate greater power compa...
Ngày tải lên: 05/09/2013, 14:59
Optimal placement of horizontal - and vertical - axis wind turbines in a wind farm for maximum power generation using a genetic algorithm
... Horizontal-axis wind turbines (HAWT); Vertical-axis wind turbines (VAWT). 1. Introduction With increased emphasis on wind power generation worldwide, the optimal placement of large number of wind- turbines ... USA. Abstract In this paper, we consider the Wind Farm layout optimization problem using a genetic algorithm. Both the Horizontal –Axis Wind Turbines (HAWT) a...
Ngày tải lên: 05/09/2013, 17:03
Báo cáo khoa học: "Multilingual Lexical Database Generation from parallel texts in 20 European languages" pptx
... processing of bilingual and multilingual corpora Processing bilingual and multilingual corpora constitutes a major area of investigation in natu- ral language processing. The linguistic and trans- lational ... Paradigms and Grounding in Natural Language Learning, pages 295-299, PaGNLL Adelaide. Gale W .A. & K.W. Church. 199 1a. Identifying word correspondences in parallel t...
Ngày tải lên: 23/03/2014, 18:20
Prospects of concentrating solar power to deliver key energy services in a developing country
... journal publications in international journals, 15 announcements in international conferences and articles published in magazines and books. E-mail address: chkara@epu.ntua.gr Charalampos ... excess installed capacity available within the SING grid [11]. In this case again creating (additional) interconnections either national (SIC grid) or international (i.e. to Bolivia, Per...
Ngày tải lên: 05/09/2013, 14:58
Báo cáo khoa học: "LANGUAGE SYNTHESIS GENERATION OF GERMAN FROM CONCEPTUAL STRUCTURE: MT PROJECT IN A JAPANESE/GERMAN" pot
... Winograd's terminology for functional gran~nar (Winograd, 1983). In general, case schemata will be mapped into CLAUSE-RS and concept schemata are mapped into NP-R~. A CLAUSE-RS has a ... representation as an interlingua in a practical application will be investigated and demonstrated by translating titles of Japanese papers from the field of "Information Technolog...
Ngày tải lên: 08/03/2014, 18:20
Báo cáo y học: "Sustained High Quality of Life in a 5-Year Long Term Follow-up after Successful Ablation for Supra-Ventricular Tachycardia. Results from a large Retrospective Patient Cohort"
... (5) and insufficient (6). Y-axis: Percentage of patients Panel A: AVNRT. Panel B: AVRT. Panel C: EAT Comparing the categorical variables before and after ablation in AVNRT patients, applying ... Atrio-Ventricular Nodal Reentry Tachycardia; AVRT: Atrio-Ventricular Reentry Tachycardia; AF: Atrial Fibrillation; EAT: Ectopic Atrial Tachycardia; F: French; INR: International Normalized Ratio; ....
Ngày tải lên: 03/11/2012, 11:44
DETOXIFICATION OF TRICHLOROETHYLENE (TCE) USING SOLAR LIGHT/TiO2 IN A UV CONCENTRATING RADIATION SYSTEM
... degraded in 3 to 4 hours of solar light illumination. Photocatalytic degradation of TCE increased linearly with increasing sunlight intensity. The degradation of TCE also increased with increasing ... They are readily removed from groundwater using well pump in one-pass solar detoxification system (Pacheco et al., 1993) and contaminated surface water can be treated in a UV conce...
Ngày tải lên: 05/09/2013, 08:40
Quantification of Microcystin-degrading Bacteria in a Biofilm from a Practical Biological Treatment Facility by Real-time PCR
... MF gacccgatgttcaagatact Saito et al., 2003b MR ctcctcccacaaatcaggac QMF agacgcacgctcacctcaa in this study QMR gagcagttcacgaaatcc QMT (Probe) atacgctcttactgtttccggccgcc BACT1369F cggtgaatacgttcycgg ... MATERIAL AND METHODS Bacterial strains and cultivation Table 1 shows the strains examined in this study. MD-1 strain was isolated from Lake Kasumigaura in Japan (Saito et al., 200 3a) ....
Ngày tải lên: 05/09/2013, 10:15
Optimum sizing of steam turbines for concentrated solar power plants
... results indicate that by increasing the capacity of the plant, the steam inlet pressure of the turbine at which maximum efficiency can be obtained increases up to a capacity of 50MWe and then remains ... are suitable in areas with high solar irradiance. CSP plants offer a noticeable advantage when compared to photovoltaics (PVs), as large amounts of thermal energy can be stored easily...
Ngày tải lên: 05/09/2013, 14:59
Economic feasibility analysis of a wind farm in Caldas da Rainha, Portugal
... and availability of wind resources in the macro defined location for the installation of central power generation, Caldas da Rainha, Portugal. The assessment of wind resources and availability ... Climate Database and Retscreen Product Database. The economic and financial evaluation of the wind farm is made by the software RETScreen® International Clean Energy Project Analysis a...
Ngày tải lên: 05/09/2013, 14:59