Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge

Ngày tải lên: 05/09/2013, 10:15

... Zhang 1 , Kazumichi Furuyama 1 , Kiriko Kaneko 1 , Yuanying Ding 1 , Kazuhiro Ogawa 2, *, Miki Yoshizawa 1 , Masaki Kawamura 1 , Kazuhisa Takeda 1 , Tadashi Yoshida 3 and Shigeki Shibahara 1 1 Department ... 116 2–1 168. 13 Nakayama M, Takahashi K, Kitamuro T, Yasumoto K, Katayose D, Shirato K, Fujii-Kuriyama Y & Shiba- hara S (2000) Repression of heme oxygenase-1 by hypoxia in vasc...

Ngày tải lên: 19/02/2014, 06:20

... For each unifying firm, we define its calendar unification year as year zero, and match the unifying firm’s data with the corresponding data of the control sample for the same calendar year. ... 1 and Table 2 present the evolution of the voting power of controlling shareholders in the main sample of unifying firms, and in the control sample of firms th...

Ngày tải lên: 07/03/2014, 01:20

... as a major component of the amyloid plaques in AD brain [42,43], global AD research focused on this peptide as a causative agent in the disease. The 3 9–4 3 amino acid cleavage product of the Ab ... but the role for metal dyshomeostasis in all aspects is clear. In the AD affected brain, metal dyshomeostasis is evident in the form of a substantial increa...

Ngày tải lên: 07/03/2014, 10:20

... the data available for training. In over-sampling, training samples of the minority class is over-sampled at random until the relative size of the minority and majority classes is more balanced. ... classification [HK01]. First, in the Learning stage, a model is learnt from a subset of the historical data, called the training set. By analyzing 7 each sampl...

Ngày tải lên: 23/03/2014, 04:21

... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGATGTTGTGATGACTCAGTCTCC VK3.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAATTGTGTTGACGCAGTCTCC VK4.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC VK5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC VK6.link ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA JH1-2.link CCACCAGAACCTCCGCCTCCTGATCCGCC...

Ngày tải lên: 23/03/2014, 13:20

... unsaturated side chain [1]. Vitamin K 2 acts as a cofactor for a vitamin K- dependent carboxylase involved in the carboxylation of coagulation factors and is an essential substrate for blood coagulation ... double- stained with annexin V and propidium iodine using the ApoAlert Annexin V-fluorescein isothiocyanate apoptosis kit (Takara Bio Inc., Shiga, Japan). DNA fragmentation...

Ngày tải lên: 30/03/2014, 03:20

... and 7 in the tail of the pancreas. Notably one patient was demonstrated to have liver metastasis. The predominant presenting complaint was abdominal pain (8/18). The rest of the patients ... uncertainty of the strategy for its treatment. While further delineati n g the clinicopathological and radiological features, and summarizing the surgical therapy strategy o...

Ngày tải lên: 25/10/2012, 11:40

... timeline. This included each of the major phases of the project (planning, train- ing, quantitative analysis, interviews, data synthesis, report prepara- tion) and set a deadline for delivery of ... series of data inputs— nature of the initiative or project, initial estimate of the ongoing economic activity related to the initiative and requests for incen- tives...

Ngày tải lên: 17/02/2014, 05:20

... reflected in the critical dimensions of seating. Because Australian anthropometric data are not available, the accompanying guidelines are based on data from various sources so as to reflect the wider ... population can be comfortably and suitably seated. With the increasing ethnic diversity of the Australian population there is a greater need to accommodate people at th...

Ngày tải lên: 08/03/2014, 13:20