A New Technique Using Headspace Gas Monitoring to Determine Carbon Source Addition in a BNR Process
Báo cáo khoa học: A new rice zinc-finger protein binds to the O2S box of the a-amylase gene promoter pptx
... O2S was synthesized by PCR
using two primers: Amyb1: 5¢-ACCCTCGAGGTCGA
CGGTATCGATAAGCTTGATTGACTTGACCGTCA
TCGGATTGACTTGACCGTCATCG-3¢,Amyb2:5¢-CA
GGATCCATCACGACAGTCAGTGCCGATGACGG
TCAAGTCAATCCGATG-3¢ ... the amino acids
within the binding domain of RAMY protein and analyzed
the time course for the induction of RAMY a nd a- amylase
mRNA by GA.
Correspondence to Q. Yao, Shanghai Key Laborat...
Bacillus thuringiensis a new perspective for an induced protection to coffee leaf rust
... 5 semanas. A prote9ao observada foi sistemica. O indice de prote^ao foi
determinado peia redugao do numerc medio de lesoes por folha. Uma redu^ao no tamanho das lesoes
nas folhas tratadas, bem ... predisposi-
tion to infection by other pathogens, have led plant pathologists to intensify the
search for alternative controls.
Several authors have found that plants can be induced to be re...
Tài liệu The Insider’s Guide to PR: Chapter 1 WORKING IN A PR CONSULTANCY doc
... of practice. In addition the PRCA’s Consultancy Management
Standard (CMS) is an external assessment based on business proficiency and all
members must pass in order to join the trade association. ... of any discipline. Account teams within a
full service consultancy, for instance, might undertake corporate, consumer,
trade, financial or even crisis management PR according to a c...
Introduction to Cost and Management Accounting in a Global Business Environment
... plans, and engaging in investor relations.
Financial Accounting compiles, analyzes, and provides
financial information to group management in respect to
domestic and international operations as ... banking or in-
surance) may mandate financial accounting practices. In other cases, financial ac-
counting information is required for obtaining loans, preparing tax returns, and un-
de...
Using peer interaction activities to teach english speaking skill in the tenth form class = sử dụng các hoạt động tương tác giữa học sinh lớp 10 để dạy kỹ năng nói tiếng anh luận văn tốt nghiệp đại học
... to be
taught, they seek to stimulate or at least maintain the students’ interest in what is to be
taught, to motivate students to learn, to enhance and maintain the learner's interest,
including ... of peer interaction in language teaching is increasing learners'
participation. In a teacher-dominated class, few students have chance to interact with the
teacher...
Tài liệu A New Angle on Sovereign Credit Risk - E-RISC: Environmental Risk Integration in Sovereign Credit Analysis ppt
... environmental degradation, separate carbon from Footprint of
production, incorporate additional measures of degradation
Increase sophistication of analysis regarding carbon pricing, trading, or taxing.
Systematise ...
situation
Ecological Footprint and biocapacity
Non-renewable natural resources
Using Input-Output analysis to analyse resource use in the economy
Better integration...
Tài liệu Báo cáo khoa học: "Know When to Hold''''Em: Shuffling Deterministically in a Parser for Non concatenative Grammars*" pdf
... most appropriate parsing algorithm
to take advantage of the information that a semantic
head provides. For example, a head usually provides
information about the remaining daughters that the ... to the proposals of Dowty,
Reape, and Kathol, and to the particular analysis
implemented here, is the characterization of nat-
ural language syntax in terms of two interrelated
but...
Báo cáo khoa học: "Learning to Win by Reading Manuals in a Monte-Carlo Framework" pot
... Manuals in a Monte-Carlo Framework
S.R.K. Branavan David Silver * Regina Barzilay
Computer Science and Artificial Intelligence Laboratory
Massachusetts Institute of Technology
{branavan, regina}@csail.mit.edu
* ... Regina Barzilay.
2010. Reading between the lines: Learning to map
high-level instructions to commands. In Proceedings
of ACL, pages 1268–1277.
S.R.K. Branavan, David Silve...