... society of the mainstream American in the twentieth and twenty-first centuries such as individualism, American informality, racial discrimination, modern American women, generation gap and American ... economy as the United States of America has become the leading power of the world, and especially witnessed dramatic changes in American society a...
Ngày tải lên: 07/11/2012, 15:01
... MFIs amongst lower income populations The data was tabulated and analyzed through qualitative analysis of the gathered data, which reveal the behaviors and decision making patterns in lower income ... sound influence on behavioral and attitudinal aspects of individuals An in- depth analysis in each of the broad parameters revealed the following: Educational Fa...
Ngày tải lên: 06/09/2013, 05:48
Tài liệu Báo cáo khoa học: Golgi reassembly stacking protein 55 interacts with membrane-type (MT) 1-matrix metalloprotease (MMP) and furin and plays a role in the activation of the MT1-MMP zymogen pdf
... et al MT1-MMP and furin can interact with GRASP55 Overexpression of GRASP55 has been found to increase the amount of complex containing MT1MMP and furin, and the expression of a catalytically inactive ... with a full-length furin cDNA, were permeabilized and stained with polyclonal antibodies against furin and GRASP55 Arrows show examples of membrane c...
Ngày tải lên: 18/02/2014, 04:20
Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx
... from the oyster Crassostrea gigas [5] Interestingly, this protein, named C gigas chitinase-like protein (CgClp1) was found to be involved in the control of growth and remodelling processes in a ... composed of the sole Glyco_18 domain, the C-terminal tail of C gigas CLPs may not noticeably contribute to the structure and the function of these proteins...
Ngày tải lên: 19/02/2014, 00:20
Tài liệu PLEASE GIVE NORBERT WEINER (AND OTHER CURIOUS DEVELOPMENTS IN THE WORK OF JANET ZWEIG) doc
... examines, and often documents the pattern of shifting individual actions, roles, and responsibilities in public space In all of these works, Arendt’s insistent appeal for thinking and seeing ... rendering of work in progress culable, the project’s denouement, determined by the actions of thousands of individuals, remains a data-producing, open-ended experiment in pub...
Ngày tải lên: 19/02/2014, 10:20
Tài liệu Design, Lifestyles and Sustainability. Aesthetic Consumption in a World of Abundance pptx
... much more of a process of social and cultural relations rather than a cognitive, single act: a process taking place in a society marked by increasing alienation, isolation and individualization (Giddens, ... implications for the understanding of sustainable development in general and sustainable consumption in particular Contemporary Studies of Sustainable Consu...
Ngày tải lên: 19/02/2014, 17:20
Báo cáo khoa học: Nuclear actin and actin-binding proteins in the regulation of transcription and gene expression docx
... 2675 Actin and ABPs in transcription regulation B Zheng et al Table Role of nuclear actin- binding proteins interacting with the androgen receptor AR, androgen receptor; LBD, ligand-binding domain ... STARS-interacting proteins These novel proteins contain four LIM domains and a C-terminal villin headpiece domain, which mediates actin- binding in several proteins,...
Ngày tải lên: 07/03/2014, 01:20
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... be other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal helix, but not the b domain The distinguishing featu...
Ngày tải lên: 07/03/2014, 05:20
Information Contagion and Inter-Bank Correlation in a Theory of Systemic Risk potx
... Information Contagion and Inter-Bank Correlation in a Theory of Systemic Risk Abstract Two aspects of systemic risk, the risk that banks fail together, are modeled and their interaction examined: ... and Mullineaux, 1987) as the formative reason for the commercial-bank clearinghouses in the U.S., and eventually for the Federal Reserve Chari and Jagannath...
Ngày tải lên: 15/03/2014, 09:20
Báo cáo khoa học: Role of the hinge peptide and the intersubunit interface in the swapping of N-termini in dimeric bovine seminal RNase pptx
... have investigated the effects of mutation of two paradigmatic residues involved in the dislocation of BS -RNase N-terminal arms, i.e Pro19 and Leu28, located in the hinge peptide and in the intersubunit ... [11] The kinetics of the N-terminal arms swapping in the P19A-BSRNase is comparable to that of BS -RNase (Fig 5B) Interestingly, the amount...
Ngày tải lên: 16/03/2014, 23:20
Báo cáo khoa học: Sp1 and Sp3 are involved in up-regulation of human deoxyribonuclease II transcription during differentiation of HL-60 cells pptx
... These sites bind Sp1 and Sp3, and protein levels and binding of Sp1 and Sp3 are increased in PMAtreated cells These findings indicate that Sp1 and Sp3 play a pivotal role in the transcriptional ... and Sp3 are able to bind to the GC boxes and that binding of Sp1 forms complex C1 and binding of Sp3 forms complexes C2 and C3 PMA treatment increa...
Ngày tải lên: 23/03/2014, 17:21
ICT enabled independent living for elderly: A status-quo analysis on products and the research landscape in the field of Ambient Assisted Living (AAL) in EU-27 doc
... A lack of information transparency and existing language barriers have therefore been an obstacle to investigations on the current European research landscape for AAL and again prove a certain ... chapters are based The main parts of this database comprise European ICT products, national and international research projects and a broad overview of roughly o...
Ngày tải lên: 28/03/2014, 16:20
Báo cáo khoa học: Roles of prolactin-releasing peptide and RFamide related peptides in the control of stress and food intake potx
... Takayanagi and T Onaka PrRP and RFRPs in metabolism and stress Table Summary of mammalian RFamide peptides and their receptors The effects of administration of RFamide peptides upon stress responses ... in the termination of meals and the induction of energy consumption Energy homeostasis and stress interact with each other Stress affects food...
Ngày tải lên: 29/03/2014, 21:20