Zeros of Polynomial Functions

Doctor of Philosophy in Mathematics Linear and Non-linear Operators, and The Distribution of Zeros of Entire Functions

Doctor of Philosophy in Mathematics Linear and Non-linear Operators, and The Distribution of Zeros of Entire Functions

... order of the sum of two functions is not greater than the larger of the orders of the two summands, and if the orders of the summands and of the sum are all equal, then 21 the type of the sum ... all the zeros of g(z) lie in (−1, 0), then the zeros of h(z) also lie in K (iii) If the zeros of f (z) lie in (−a, a) and the zeros...

Ngày tải lên: 10/03/2014, 16:15

104 495 0
Báo cáo toán học: "Zeros of the Jones polynomial are dense in the complex plane" pdf

Báo cáo toán học: "Zeros of the Jones polynomial are dense in the complex plane" pdf

... shall show that, on the contrary, zeros of Jones polynomial of knots are dense in the whole complex plane We point out that Sokal proved that chromatic roots are dense in the whole complex plane [10], ... lemma, we prove that zeros of the Jones polynomial of pretzel knots are dense in the complex plane the electronic journal of combinatori...

Ngày tải lên: 08/08/2014, 12:22

10 302 0
Representation of nonnegative Morse polynomial functions and applications in Polynomial Optimization

Representation of nonnegative Morse polynomial functions and applications in Polynomial Optimization

... KG , each lying in the interior of KG Then f ∈ TG Proof The proof follows from Theorem and Theorem Applications in polynomial Optimization 4.1 Unconstrained polynomial Optimization In this section ... vectors in Zn of the form λw, λ > Denote by F(Γ ) the family of primitive vectors supporting some face of Γ of dimension n − Representation of Morse polynomi...

Ngày tải lên: 14/10/2015, 08:30

15 317 0
Tài liệu Reserve Bank of India: Functions and Working doc

Tài liệu Reserve Bank of India: Functions and Working doc

... Reserve Bank of India: Functions and Working ž¸¸£·¸ú¡¸ ¹£ö¸¨¸Ä ¤¸ÿˆ RESERVE BANK OF INDIA www.rbi.org.in Foreword The Reserve Bank of India, the nation’s central bank, began operations ... Publications by the Reserve Bank 112 Annex – List of Abbreviations 114 Index on Boxes S No Name of the Box Item Origins of the Reserve Bank of India Functions...

Ngày tải lên: 16/02/2014, 10:20

122 483 0
Đề tài " Norm preserving extensions of holomorphic functions from subvarieties of the bidisk " potx

Đề tài " Norm preserving extensions of holomorphic functions from subvarieties of the bidisk " potx

... Annals of Mathematics, 157 (2003), 289–312 Norm preserving extensions of holomorphic functions from subvarieties of the bidisk By Jim Agler and John E McCarthy* Introduction A basic result in the theory ... proof in an appendix at the end of the paper 295 HOLOMORPHIC FUNCTIONS The equivalence of the von Neumann inequality and the extension property...

Ngày tải lên: 05/03/2014, 23:20

25 276 0
Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt

Báo cáo khoa học: Two types of replication protein A in seed plants Characterization of their functions in vitro and in vivo ppt

... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC...

Ngày tải lên: 07/03/2014, 21:20

12 588 0
Đề tài " On the homology of algebras of Whitney functions over subanalytic sets " doc

Đề tài " On the homology of algebras of Whitney functions over subanalytic sets " doc

... Localization techniques Peetre-like theorems Hochschild homology of Whitney functions Hochschild cohomology of Whitney functions Cyclic homology of Whitney functions Whitney- de Rham cohomology of subanalytic ... subanalytic subsets, one calls the triangulation T compatible with the Xj , if every one of the sets Xj is a union of simplices h(Δ), THE...

Ngày tải lên: 22/03/2014, 20:21

53 389 0
Báo cáo khoa học: "A Class of Submodular Functions for Document Summarization" pot

Báo cáo khoa học: "A Class of Submodular Functions for Document Summarization" pot

... processing for the tasks of document summarization (Lin and Bilmes, 2010) and word alignment (Lin and Bilmes, 2011) Submodular functions share a number of properties in common with convex and concave functions ... monotone submodular function yields a submodular function, and summing them all together retains submodularity, as mentioned in Section The monotonicity of R(S)...

Ngày tải lên: 23/03/2014, 16:20

11 440 0
Báo cáo khoa học: " Determination of Syntactic Functions in Estonian Constraint Grammar " docx

Báo cáo khoa học: " Determination of Syntactic Functions in Estonian Constraint Grammar " docx

... Fred Karlsson 1990 Constraint Grammar as a framework for parsing running text Proceedings of COLING-90 Vol 3, 168-173, Helsinki Tiina Puolakainen 1998 Developing Constraint Grammar for Morphological ... supervision of trustee.' Conclusions In this paper I described my work on the syntactic part of Estonian Constraint Grammar parser The error rate of parser is 1-4% de...

Ngày tải lên: 24/03/2014, 03:21

2 244 0
kennelly arthur application of hyperbolic functions to electrical engineering problems

kennelly arthur application of hyperbolic functions to electrical engineering problems

... THE APPLICATION OF HYPERBOLIC FUNCTIONS TO WIRE TELEPHONY 112 !X X 86 THE APPLICATION OF HYPERBOLIC FUNCTIONS TO WIRE TELEGRAPHY 179 HYPERBOLIC APPLICATIONS OF MISCELLANEOUS FUNCTIONS TO ELECTRICAL ... radius -vector As the radius-vector ; ÆTHE ORCE RF TO ELECTRICAL ENGINEERING PROBLEMS describes * a hyperbolic sector a circular angle /?=AOE, and also a...

Ngày tải lên: 04/06/2014, 12:30

314 334 0
báo cáo hóa học:"On quotients and differences of hypergeometric functions" pptx

báo cáo hóa học:"On quotients and differences of hypergeometric functions" pptx

... continue the discussion of some of the questions for quotients and differences of hypergeometric functions that were left open in [2] Motivated by the asymptotic behavior of the function F (x) = ... g(y) ≥ g(x + y − xy), and the proof of the first part of Theorem 3.6 is complete The proof of the second part is similar Note that the condition c ∈ (1/2, ∞), d ≥ c/(2c − 1) o...

Ngày tải lên: 18/06/2014, 15:20

17 381 0
Báo cáo sinh học: " The herpes simplex virus UL20 protein functions in glycoprotein K (gK) intracellular transport and virus-induced cell fusion are independent of UL20 functions in cytoplasmic virion envelopment" docx

Báo cáo sinh học: " The herpes simplex virus UL20 protein functions in glycoprotein K (gK) intracellular transport and virus-induced cell fusion are independent of UL20 functions in cytoplasmic virion envelopment" docx

... from domains functioning in UL20p/gK intracellular transport and virus- induced cell fusion Conclusion These results show that UL20p domains required for UL20p and gK intracellular transport and TGN ... encoding glycoprotein B (gB) [13,14], and the UL53 gene coding for glycoprotein K (gK) [15-19] Of these four membrane associated proteins, only UL20 and...

Ngày tải lên: 18/06/2014, 18:20

12 526 0
Báo cáo sinh học: " Modulation of macrophage functions by sheeppox virus provides clues to understand interaction of the virus with host immune system" docx

Báo cáo sinh học: " Modulation of macrophage functions by sheeppox virus provides clues to understand interaction of the virus with host immune system" docx

... mechanism of immune escape, and second, to evaluate the potential beneficial systemic effect of SPPV on the host immune system Early immune response to SPPV at the site of inoculation provides ... response by SPPV is not dependent on virus infectivity Later and systemically, the virus protects the host from any fatal consequences of the suppression o...

Ngày tải lên: 18/06/2014, 22:20

7 353 0
w