Sequences and Their Notations
Báo cáo hóa học: "EXTENDING GENERALIZED FIBONACCI SEQUENCES AND THEIR BINET-TYPE FORMULA" pot
... Rachidi, and O Saeki, Approximation of ∞ -generalized Fibonacci sequences and their asymptotic Binet formula, The Fibonacci Quarterly 39 (2001), no 2, 168– 180 , On periodic ∞ -generalized Fibonacci sequences, ... Miles Jr., Generalized Fibonacci numbers and associated matrices, The American Mathematical Monthly 67 (1960), no 8, 745–752 [7] W Motta, M Rachidi, and O S...
Ngày tải lên: 22/06/2014, 22:20
Báo cáo hóa học: " Multipattern Consensus Regions in Multiple Aligned Protein Sequences and Their Segmentation" pot
... evaluating consensus regions in multiple aligned protein sequences This paper presents an outline of the segmentation algorithm (see Yan [10]) for multipattern consensus regions in aligned protein sequences, ... overlapping regions Gap exists between some regions The result shows that the positions of the p53 sequences form clear regions There are D -regions...
Ngày tải lên: 22/06/2014, 22:20
study of the relationship between mus musculus protein sequences and their biological functions
... STUDY OF THE RELATIONSHIP BETWEEN Mus musculus PROTEIN SEQUENCES AND THEIR BIOLOGICAL FUNCTIONS Pawan Seth Thesis Approved: Accepted: ... upon the homology between proteins In this thesis, we present the similarity relationship between protein sequences and functions for mouse proteome in the context of gene ontology slim The similarity ... fi...
Ngày tải lên: 30/10/2014, 20:13
Báo cáo khoa học: Platination of telomeric sequences and nuclease hypersensitive elements of human c-myc and PDGF-A promoters and their ability to form G-quadruplexes Viktor Viglasky potx
... platinum, but not nuclease hypersensitive elements of human c-myc and PDGF-A promoters; the abundance of unfolded DNA is proportional to the platinum concentration Results CD spectrum of G-rich oligonucleotides ... my student Lubos Bauer and Professor Viktor Brabec for the opportunity to work in his laboratory and obtain skills with respect to DNA platination...
Ngày tải lên: 23/03/2014, 06:20
Báo cáo y học: "Genetic analysis of HIV-1 Circulating Recombinant Form 02_AG, B and C subtype-specific envelope sequences from Northern India and their predicted co-receptor usage" pot
... Reverse primer: CACTTCTCCAATTGTCCCTCA Patient population and genetic analysis < /b> We carried out genetic analysis < /b> of < /b> 13 HIV-1 < /b> envelope sequences from Northern India Nine unrelated and mother-child pairs ... likely that subtypes other than B may also cocirculate, creating an ideal situation for the formation of < /b> recombinants With this in mind, we g...
Ngày tải lên: 10/08/2014, 05:21
báo cáo khoa học: " Frequency, type, and distribution of EST-SSRs from three genotypes of Lolium perenne, and their conservation across orthologous sequences of Festuca arundinacea, Brachypodium distachyon, and Oryza sativa" ppt
... objectives of this study were 1) to analyse the frequency, type, and distribution of SSR motifs in ESTs derived from three genotypes of L perenne, 2) to perform a comparative analysis of SSR motif ... gous sequences of these species The blast searches resulted in 833, 540, and 26 orthologous sequences of F arundinacea, B distachyon, and O sativa, resp...
Ngày tải lên: 12/08/2014, 05:20
Báo cáo sinh học: "Hobo elements and their deletion-derivative sequences in Drosophila melanogaster and its sibling species D simulans, D mauritiana and D sechellia" pptx
... melanogaster, D simulans, D mauritania and D secheddia are reported Their structure is analysed and the maintenance of the activity of hobo elements during evolution is discussed MATERIALS AND METHODS The ... only species in which hobos have been found Homologous sequences have been detected in the sibling species D simudans and D mauritiana which contai...
Ngày tải lên: 14/08/2014, 20:20
Universal simplicial monoid constructions on simplicial categories and their associated spectral sequences
... singleton {∗} 3.2 Simplicial Monoid Actions Before we describe simplicial monoid actions, let us first review monoid actions Definition 3.2.1 Let X be a set and M be a monoid A monoid action M X ... Mon Monoids and monoid homomorphisms Grp Groups and group homomorphisms MonAct Monoid actions and morphisms of monoid actions Cop Opposite category of C PtC Pointed objec...
Ngày tải lên: 09/09/2015, 17:57
Attackers and Their Attacks
... disinformation and propaganda – Deny service to legitimate computer users – Commit unauthorized intrusions into systems and networks that result in critical infrastructure outages and corruption ... infrastructure outages and corruption of vital data Understanding Basic Attacks • Today, the global computing infrastructure is most likely target of attacks • Attackers are becoming...
Ngày tải lên: 17/09/2012, 10:43
Báo cáo y học: " Predictors of hepatic steatosis in HBeAg-negative chronic hepatitis B patients and their diagnostic values in hepatic fibrosis"
... fixed in < /b> buffered formalin, embedded in < /b> paraffin, and stained with hematoxylin-eosin-safran and Masson's trichrome Hepatic < /b> steatosis,< /b> stage of < /b> fibrosis and grade of < /b> disease activity were determined ... shown in < /b> Table TG, GGT, Glb, and FINS were all associated with hepatic < /b> inflammation in < /b> each stage among HBeAg-negative < /...
Ngày tải lên: 25/10/2012, 11:48
GROWTH PERFORMANCE AND SPERM QUALITY OF STRESS NEGATIVE PIÉTRAIN BOARS AND THEIR HYBRIDS WITH DUROC
... coefficient of determination 219 Growth Performance and Sperm Quality of Stress Negative Piétrain Boars and Their Hybrids with Duroc Table Production performance, Least square means (LSMSE) of PiDu and ... Growth Performance and Sperm Quality of Stress Negative Piétrain Boars and Their Hybrids with Duroc Kawecka et al (2008),...
Ngày tải lên: 28/08/2013, 11:59
Frequency of Routine and Flooding-stage Observations for Precise Annual Total Pollutant Loads and their Estimating Method in the Yodo River
... the annual total pollutant loads during observation periods and to clarify the optimum frequency of routine observation for precise estimation of annual total pollutant loads The flow in the ... during one of the five flooding events The data reflected the differences in traveling time of river water from their main pollutant sources...
Ngày tải lên: 05/09/2013, 09:38
Undaria pinnatifida Habitat Loss in Relation to Sea Urchin Grazing and Water Flow Conditions, and Their Restoration Effort in Ogatsu Bay, Japan
... pressure of sea urchin 80 70 60 50 40 2003 30 2004 20 10 0 10 20 30 40 50 Density of sea urchin (ind m-2) 70 50 60 U pinnatifida (Line 1) U pinnatifida (Line 2) Sea urchin (Line 1) Sea urchin (Line 2) ... using 0.25 m2 quadrat in each area Restoration effort We performed a U pinnatifida restoration effort to reduce the effects of grazing pressure of sea u...
Ngày tải lên: 05/09/2013, 09:38
Nitrogen Dynamics and Biomass Production in a Vertical Flow Constructed Wetland Cultivated with Forage Rice and their Mathematical Modeling
... the leaf area Roughly, the plant height increased until 120 days after transplantation, and thereafter a constant height was maintained in every case The leaf area index (LAI), however, increased ... with forage rice is a fascinating subject To design an adequate VF constructed wetland using forage rice, it is required to understand in detail the dynamics of nutrients...
Ngày tải lên: 05/09/2013, 09:38