Graphs of Polynomial Functions

... Chi, Local polynomial convexity of certain graphs in C2 , Michigan Math J 58 (2), 479-488 (2009) [7] Nguyen Quang Dieu, Local polynomial convexity of tangentials union of totally real graphs in ... (X)) then P (X) = C(X) Local polynomial convexity of graphs in Cn Now we come to the main results of this work Theorem 3.1 Let U be a open neighborhood of...

Ngày tải lên: 14/10/2015, 08:00

... set W of indices write AW for the submatrix of A consisting of all rows and columns index with elements of W It is easy to see by inspection that each of the blocks Adj(A)γi (a) is of one of the ... the case of a prime number n of vertices, i.e we shall propose a still somewhat complicated, but nevertheless time -polynomial, method for recognizing arbitrary circulant gr...

Ngày tải lên: 07/08/2014, 06:22

... electronic journal of combinatorics (2001), #R26 the investigation to certain subclasses of circulants It is in this context that S-ring theory becomes useful Subclasses of circulants can be characterized ... idea of working with the interplay between association schemes and S-rings has been successfully employed in [21] for the case of circulants on a prime number of vertic...

Ngày tải lên: 07/08/2014, 06:22

... computations of bounded portions of the interlace polynomials for graphs in classes of bounded tree-width and more generally of bounded clique-width The proof uses descriptions of interlace polynomials ... the bounds for the interlace polynomial C and its specializations Theorem 23 is actually a corollary of Theorem 31 Proof of Theorem 23: For each k,...

Ngày tải lên: 07/08/2014, 21:20

... algebra and weighted graphs Advances in Soviet Mathematics, 21:135–145, 1994 [12] J Edmonds Systems of distinct representatives and linear algebra Journal of Research of the National Bureau of Standards ... Many well-studied classes of graphs have bounded tree-width: for instance, seriesparallel networks are the graphs with tree-width at most two A large class of gr...

Ngày tải lên: 07/08/2014, 21:21

... KG , each lying in the interior of KG Then f ∈ TG Proof The proof follows from Theorem and Theorem Applications in polynomial Optimization 4.1 Unconstrained polynomial Optimization In this section ... vectors in Zn of the form λw, λ > Denote by F(Γ ) the family of primitive vectors supporting some face of Γ of dimension n − Representation of Morse polynomi...

Ngày tải lên: 14/10/2015, 08:30

... Reserve Bank of India: Functions and Working ž¸¸£·¸ú¡¸ ¹£ö¸¨¸Ä ¤¸ÿˆ RESERVE BANK OF INDIA www.rbi.org.in Foreword The Reserve Bank of India, the nation’s central bank, began operations ... Publications by the Reserve Bank 112 Annex – List of Abbreviations 114 Index on Boxes S No Name of the Box Item Origins of the Reserve Bank of India Functions...

Ngày tải lên: 16/02/2014, 10:20

... Annals of Mathematics, 157 (2003), 289–312 Norm preserving extensions of holomorphic functions from subvarieties of the bidisk By Jim Agler and John E McCarthy* Introduction A basic result in the theory ... proof in an appendix at the end of the paper 295 HOLOMORPHIC FUNCTIONS The equivalence of the von Neumann inequality and the extension property...

Ngày tải lên: 05/03/2014, 23:20

... F1 (ATGGAGAACTCAGT GACCCAAGATGGTAT) and 70b R1 (AGAATTCTGAG GTTGAAGAAGCTAGTAA) primers, and 70b F2 (TACT ATCAGCAGAAGCAATGTGGTGATA) and 70b R2 (TTACTGAGATGTCTTGTTCTTGGAAATGT) primers for atrpa70b ... DNA binding and chromatin association of ATR (ataxia telangiectasia-mutated and Rad3-related) in vitro via ATR interacting protein [4,22,23] Rad17 and Rad9 complexes (Rad17–RFC...

Ngày tải lên: 07/03/2014, 21:20

... order of the sum of two functions is not greater than the larger of the orders of the two summands, and if the orders of the summands and of the sum are all equal, then 21 the type of the sum ... all the zeros of g(z) lie in (−1, 0), then the zeros of h(z) also lie in K (iii) If the zeros of f (z) lie in (−a, a) and the zeros...

Ngày tải lên: 10/03/2014, 16:15

... Localization techniques Peetre-like theorems Hochschild homology of Whitney functions Hochschild cohomology of Whitney functions Cyclic homology of Whitney functions Whitney- de Rham cohomology of subanalytic ... subanalytic subsets, one calls the triangulation T compatible with the Xj , if every one of the sets Xj is a union of simplices h(Δ), THE...

Ngày tải lên: 22/03/2014, 20:21

... processing for the tasks of document summarization (Lin and Bilmes, 2010) and word alignment (Lin and Bilmes, 2011) Submodular functions share a number of properties in common with convex and concave functions ... monotone submodular function yields a submodular function, and summing them all together retains submodularity, as mentioned in Section The monotonicity of R(S)...

Ngày tải lên: 23/03/2014, 16:20

... Fred Karlsson 1990 Constraint Grammar as a framework for parsing running text Proceedings of COLING-90 Vol 3, 168-173, Helsinki Tiina Puolakainen 1998 Developing Constraint Grammar for Morphological ... supervision of trustee.' Conclusions In this paper I described my work on the syntactic part of Estonian Constraint Grammar parser The error rate of parser is 1-4% de...

Ngày tải lên: 24/03/2014, 03:21

... Annals of Mathematics, 167 (2008), 625–642 Uniform expansion bounds for Cayley graphs of SL2(Fp) By Jean Bourgain and Alex Gamburd* Abstract We prove that Cayley graphs of SL2 (Fp ) are ... UNIFORM EXPANSION BOUNDS FOR CAYLEY GRAPHS OF SL2 (Fp ) 627 Our second result shows that random Cayley graphs of SL2 (Fp ) are expanders (Given a group G, a rand...

Ngày tải lên: 29/03/2014, 07:20