Cell Growth and Division

Báo cáo sinh học: "Differences in the way a mammalian cell and yeast cells coordinate cell growth and cell-cycle progression" ppt

Báo cáo sinh học: "Differences in the way a mammalian cell and yeast cells coordinate cell growth and cell-cycle progression" ppt

... Schwann cells maintain a constant average size with repeated passaging We purified Schwann cells from postnatal day rat sciatic nerve by sequential immunopanning We maintained the cells in a proliferative ... big mammalian cells have been observed to grow faster than small cells of the same type and at the same point of the cell cycle It thus seems likely that mo...

Ngày tải lên: 06/08/2014, 18:20

10 424 0
Báo cáo y học: "Functional characterization of Trip10 in cancer cell growth and survival" ppsx

Báo cáo y học: "Functional characterization of Trip10 in cancer cell growth and survival" ppsx

... University Results Immunostaining Trip10 is differentially methylated in human cancer cell lines and primary tumor specimens Cells were fixed in 2% formaldehyde in phosphate buffered saline (PBS) and ... Overexpression of Trip10 in IMR-32 cells caused Trip10 and huntingtin to colocalize and form perinuclear foci In contrast, while overexpression of Trip10 in...

Ngày tải lên: 10/08/2014, 05:21

10 438 1
báo cáo khoa học: "Transcriptional analysis of cell growth and morphogenesis in the unicellular green alga Micrasterias (Streptophyta), with emphasis on the role of expansin" pot

báo cáo khoa học: "Transcriptional analysis of cell growth and morphogenesis in the unicellular green alga Micrasterias (Streptophyta), with emphasis on the role of expansin" pot

... participated in the synchronization and RNA-extraction and in the interpretation of the data JG and LDV participated in the design of the experiments DI and WV conceived and supervised the study ... Vannerum et al.: Transcriptional analysis of cell growth and morphogenesis in the unicellular green alga Micrasterias (Streptophyta), w...

Ngày tải lên: 11/08/2014, 11:21

17 563 0
Study of human nasal epithelial stem or progenitor cell growth and differentiation in an in vitro system

Study of human nasal epithelial stem or progenitor cell growth and differentiation in an in vitro system

... alpha nasal epithelial stem or progenitor cells inner dynein arms immunofluorescence intraflagellar transport also Tg737, intraflagellar transport 88 intraflagellar transport protein A intraflagellar ... microorganism stimulation and inflammatory cells disorder, epithelial damage and remodeling occurred in NPs Epithelial repair and damage As the results of genetic pred...

Ngày tải lên: 09/09/2015, 11:29

259 930 0
Roles of BNIPXL in regulating cell growth and morphology

Roles of BNIPXL in regulating cell growth and morphology

... and cell lines 133 3.2.1.2 Expression profile of BNIPXL in murine tissues and cell lines 134 3.2.2 Domain architecture of BNIPXL constructs 140 3.2.3 BNIPXL contains a functional protein-protein ... analyses of the BNIP-2 family 129 3.2 Investigating the biochemical and cellular functions of 133 BNIPXL 3.2.1 Expression profile of BNIPXL 133 3.2.1.1 Expression p...

Ngày tải lên: 16/09/2015, 08:31

291 365 0
Dual activation of estrogen receptor a and aryl hydrocarbon receptor by the prenylflavone, icaritin restrict breast cancer cell growth and destabilize estrogen receptor a protein

Dual activation of estrogen receptor a and aryl hydrocarbon receptor by the prenylflavone, icaritin restrict breast cancer cell growth and destabilize estrogen receptor a protein

... Despite the availability of therapies targeting estrogen and growth factor signaling pathways, the incidence and mortality of breast cancers have not decline at the same rate as other major causes of ... 36 1.8 Icaritin and cancer cell proliferation 1.8.1 Icaritin and cancer cell proliferation Herba Epimedii is officially listed in China as an herb that p...

Ngày tải lên: 04/10/2015, 17:05

134 459 0
Phytohormones on cell growth and taxol accumulation via cell culture of taxus wallichiana zucc

Phytohormones on cell growth and taxol accumulation via cell culture of taxus wallichiana zucc

... information of Taxus cell culture 27 2.6.2 Two stage culture 31 2.6.3 Effect of some physical and chemical factors on cell growth and taxol accumulation of Taxus cell suspension ... kinetic of callus growth 66 4.2 Cell suspension culture 67 4.2.1 Establishment of cell suspension culture 67 4.2.2 Effect of phytohormones on cell suspension...

Ngày tải lên: 23/10/2015, 15:38

122 839 0
Báo cáo y học: " Distinguishing between linear and exponential cell growth during the division cycle: Single-cell studies, cell-culture studies, and the object of cell-cycle research" ppsx

Báo cáo y học: " Distinguishing between linear and exponential cell growth during the division cycle: Single-cell studies, cell-culture studies, and the object of cell-cycle research" ppsx

... Biosynthesis rates of the various components of the bacterial cell during the division cycle [48] Figure Biosynthesis rates of the various components of the bacterial cell during the division cycle ... set of experimental results Figure during the division cycle Cell cycle analysis of leucine uptake (and protein synthesis) Cell cycle analysis of...

Ngày tải lên: 13/08/2014, 23:20

15 307 0
Control of Cell Proliferation and Growth byMyc Proteins

Control of Cell Proliferation and Growth byMyc Proteins

... required for cell proliferation and cell growth or whether its essential role in proliferation is restricted to specific cell types Control of Cell Proliferation and Growth by Myc Proteins 331 ... targets of Myc in cell proliferation and their proposed functions Control of Cell Proliferation and Growth by Myc Proteins 333 2003) There is clear e...

Ngày tải lên: 25/10/2013, 21:20

14 376 0
Tài liệu Growth and nutritional status of children with homozygous sickle cell disease ppt

Tài liệu Growth and nutritional status of children with homozygous sickle cell disease ppt

... GR Prepubertal growth and skeletal maturation in children with sickle cell disease Pediatrics 1986; 78:124–32 33 Silva CM, Viana MB Growth deficits in children with sickle cell disease Arch Med ... 27% of 131 children with sickle cell anaemia (,18 yrs) had weights and heights ,22 SD compared with African multi-ethnic reference values.52 In Zambian chil...

Ngày tải lên: 12/02/2014, 19:20

25 603 0
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

... GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGA...

Ngày tải lên: 19/02/2014, 05:20

14 517 0
Tài liệu Báo cáo khoa học: Inhibition of pneumococcal choline-binding proteins and cell growth by esters of bicyclic amines pptx

Tài liệu Báo cáo khoa học: Inhibition of pneumococcal choline-binding proteins and cell growth by esters of bicyclic amines pptx

... shown) Inhibition of pneumococcal murein hydrolases by bicyclic amines As shown above, tropic esters of bicyclic amines were selected and characterized by biophysical methods as strong ligands ... that the bicyclic amines are also able to bind to the active site of Pce Effect of choline analogs on cell growth and viability Fig Effect of choline and an...

Ngày tải lên: 19/02/2014, 05:20

13 465 0
Báo cáo khoa học: Injection of poly(b-L-malate) into the plasmodium of Physarum polycephalum shortens the cell cycle and increases the growth rate pot

Báo cáo khoa học: Injection of poly(b-L-malate) into the plasmodium of Physarum polycephalum shortens the cell cycle and increases the growth rate pot

... increases the growth rate and shortens the duration of the cell cycle is the polymer-inherent isosterism of the carboxylates with the array of phosphates in nucleic acids and, consequently, the ... the mechanism(s) underlying the increase in the growth rate and the shortening of the cell cycle might be related to the ability of PMLA...

Ngày tải lên: 16/03/2014, 18:20

7 325 0
Báo cáo khoa học: Acetylcholinesterase in cell adhesion, neurite growth and network formation pot

Báo cáo khoa học: Acetylcholinesterase in cell adhesion, neurite growth and network formation pot

... globular domain IV of the b1 chain of laminin [23] In vitro binding studies similarly indicated binding of acetylcholinesterase to laminin-1 [24], which was inhibited by peripheral anionic site inhibitors ... extracellular space to the cytoskeleton and intracellular signaling pathways [32] Laminin is able to regulate neurite outgrowth via integrins and also by binding to other prote...

Ngày tải lên: 23/03/2014, 07:20

7 384 0
Từ khóa:
w