17 4 K Ngoai TK Multiple bur hole surgery for the treatment of Moyamoya Disease

 Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)

Báo cáo y học: "Comparison of a Two-Lead, Computerized, Resting ECG Signal Analysis Device, the MultiFunction-CardioGramsm or MCG (a.k.a. 3DMP), to Quantitative Coronary Angiography for the Detection of Relevant Coronary Artery Stenosis (70%)

... Coronary angiography remains the gold standard for the morphologic diagnosis of CAD and also allows revascularization during the same procedure [12, 13] Coronary angiography is a relatively safe and ... Combined Analysis Total USA Asia Germany female male < 65 years 65+ years Female, < 65 years Female, 65+ years Male, < 65 years Male, 65+ years No Revasc PCI CABG Revasc...

Ngày tải lên: 03/11/2012, 10:58

13 684 0
Tài liệu Multiple Vulnerabilities qualitave data for the stydy of orpharns and vulnerable children in South Africa ppt

Tài liệu Multiple Vulnerabilities qualitave data for the stydy of orpharns and vulnerable children in South Africa ppt

... countries in southern Africa, these being South Africa, Botswana and Zimbabwe The project aims to contribute towards improvement of the conditions of OVC in these countries In South Africa, the HSRC ... taking in children for the purposes to take advantage of their grants A number were accused of taking the grants for themselves and providing minimal...

Ngày tải lên: 19/02/2014, 00:20

118 629 0
The Eugenic Marriage, Vol 2 (of 4), by W. Grant Hague This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Pro pptx

The Eugenic Marriage, Vol 2 (of 4), by W. Grant Hague This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever. You may copy it, give it away or re-use it under the terms of the Pro pptx

... The Project Gutenberg EBook of The Eugenic Marriage, Vol (of 4), by W Grant Hague This eBook is for the use of anyone anywhere at no cost and with almost no restrictions whatsoever You may copy ... You may copy it, give it away or re -use it under the terms of the Project Gutenberg License included...

Ngày tải lên: 22/03/2014, 23:20

634 1K 0
Báo cáo hóa học: "Adaptive robot training for the treatment of incoordination in Multiple Sclerosis" doc

Báo cáo hóa học: "Adaptive robot training for the treatment of incoordination in Multiple Sclerosis" doc

... Phases of the training protocol: Baseline (B1), Robot Training, Baseline (B2), Subject Training, Wash-out The phases in which the robot generates no forces (B1, B2, Wash-out) are indicated in white ... the treatment itself but by variation of the clinical scale at the beginning of the therapy To test the overall effect of adaptive training, we compared...

Ngày tải lên: 19/06/2014, 08:20

11 596 0
SURGICAL OPTIONS FOR THE TREATMENT OF HEART FAILURE - PART 4 pot

SURGICAL OPTIONS FOR THE TREATMENT OF HEART FAILURE - PART 4 pot

... cenfres dedicated to the heart failure Roy Masters (editor) Surgical Options for the Treatment of Heart Failure 6 1-9 1 © 1999 Kluwer Academic Publishers Printed in the Netherlands 62 Lynne Warner ... consideration of all other medical and surgical options, the expected benefit of trans-planiation for botli fimction and sm-iaval is oiwious For the pat...

Ngày tải lên: 11/08/2014, 15:20

20 349 0
iec 60269-4-1 low-voltage fuses - supplementary requirements for fuse-links for the protection of

iec 60269-4-1 low-voltage fuses - supplementary requirements for fuse-links for the protection of

... message: please call the Document Policy Group at 30 3-3 9 7-2 295 6026 9-4 -1 © IEC: 2002 –9– LOW-VOLTAGE FUSES – Part 4-1 : Supplementary requirements for fuse-links for the protection of semiconductor ... call the Document Policy Group at 30 3-3 9 7-2 295 6026 9-4 -1 © IEC: 2002 –7– INTERNATIONAL ELECTROTECHNICAL COMMISSION _ LOW-VOLTAGE FUS...

Ngày tải lên: 25/12/2013, 10:54

42 420 2
iec 60269-4 low-voltage fuses - supplementary requirements for fuse-links for the protection of s

iec 60269-4 low-voltage fuses - supplementary requirements for fuse-links for the protection of s

... arrangements for other kinds of fuse-links are given in IEC 6026 9-2 -1 : Supplementary requirements for fuses for use by authorised persons (fuses mainly for industrial application) and IEC 6026 9-3 -1 : Supplementary ... utilis s pour la protection des dispositifs semi-conducteurs Low-voltage fuses Part 4: Supplementary requirements for fuse-link...

Ngày tải lên: 25/12/2013, 10:55

87 405 1
Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

Tài liệu Báo cáo khoa học: A novel coupled enzyme assay reveals an enzyme responsible for the deamination of a chemically unstable intermediate in the metabolic pathway of 4-amino-3-hydroxybenzoic acid inBordetellasp. strain 10d doc

... metacleavage pathway of 2-aminophenol in Pseudomonas sp strain AP-3 (A) Proposed pathway of 4-amino-3-hydroxybenzoic acid in Bordetella sp strain 10d (10) I, 4-amino-3hydroxybenzoic acid; II, 2-amino-5carboxymuconic ... of a mutant, strain Y-2, of the aniline-assimilating Pseudomonas sp strain AW-2 [20] Results Spectral changes during metabolism of 4-amino...

Ngày tải lên: 19/02/2014, 16:20

7 613 1
GET 6 ISSUES FOR THE PRICE OF 4 * doc

GET 6 ISSUES FOR THE PRICE OF 4 * doc

... KENNETH E SCOTT O ne of the most feared events in banking is the cry of systemic risk It matches the fear of a cry of “fire!” in a crowded theater or other gatherings But unlike fire, the term systemic ... made for cases of systemic risk, but it is viewed skeptically; to invoke it, the FDIC must have the concurrence in writing of two-thirds of the Federal Reserve...

Ngày tải lên: 06/03/2014, 10:20

22 363 0
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc

... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... as a direct electron acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on...

Ngày tải lên: 07/03/2014, 12:20

11 571 0
Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx

Báo cáo Y học: Guanosine diphosphate-4-keto-6-deoxy-D-mannose reductase in the pathway for the synthesis of GDP-6-deoxy-D-talose in Actinobacillus actinomycetemcomitans potx

... Nakano, Y. , Yoshida, Y. , Nakao, H., Yamashita, Y & Koga, T (2000) Genetic analysis of the gene cluster for the synthesis of serotype a-specific polysaccharide antigen in Actinobacillus actinomycetemcomitans ... encoding the biosynthesis of GDP-6-deoxy-D-talose nor its corresponding protein has been found Recently, we cloned and characterized a gene cluster involve...

Ngày tải lên: 17/03/2014, 10:20

9 626 0
Báo cáo hóa học: " Unscented Kalman filter with parameter identifiability analysis for the estimation of multiple parameters in kinetic models" pptx

Báo cáo hóa học: " Unscented Kalman filter with parameter identifiability analysis for the estimation of multiple parameters in kinetic models" pptx

... number), in the order of the highest to the lowest sensitivity To make the adjustment of the net influence of each of the remaining parameters on the already selected parameters, all of the original ... total of 54 parameters All the 54 known parameters were used initially for developing the synthetic measurement data In testing both the identif...

Ngày tải lên: 20/06/2014, 22:20

8 382 0
Báo cáo hóa học: " Effect of triplet multiple quantum well structures on the performance of blue phosphorescent organic light emitting diodes" potx

Báo cáo hóa học: " Effect of triplet multiple quantum well structures on the performance of blue phosphorescent organic light emitting diodes" potx

... Effect of triplet multiple quantum well structures on the performance of blue phosphorescent organic light- emitting diodes Seokjae Lee†1, Jaryong Koo†1, Gunwoo Hyung†1, Donghwan Lim1, Donghyung ... the other devices due to a relatively narrow emissive region Conclusions In conclusion, the present study reports on the high efficiency blue PHOLEDs based...

Ngày tải lên: 20/06/2014, 23:20

12 418 0
Báo cáo hóa học: " Multiple-Clock-Cycle Architecture for the VLSI Design of a System for Time-Frequency Analysis" doc

Báo cáo hóa học: " Multiple-Clock-Cycle Architecture for the VLSI Design of a System for Time-Frequency Analysis" doc

... Editor of the IEEE Transactions on Image Processing He is a Member of the Yugoslav Engineering Academy, and a Member of the National Academy of Science and Art of Montenegro (CANU) Professor Stankovi´ ... MCI design is much shorter Finally, the ability to realize almost all commonly used TFDs by the same hardware represents a major advantage of the proposed MCI...

Ngày tải lên: 22/06/2014, 23:20

18 385 0
Báo cáo toán học: "Colouring 4-cycle systems with specified block colour patterns: the case of embedding P3-designs" ppsx

Báo cáo toán học: "Colouring 4-cycle systems with specified block colour patterns: the case of embedding P3-designs" ppsx

... prove that the existence of a 4-cycle system of order n having an m-colouring of type bd, implies the one of a 4-cycle system of order n + having an (m + 1)-colouring of type bd 2-Colouring of type ... a 4-cycle system of order n with a proper m-colouring of type bf Proof The cases m = and m = n+3 are proved by using Theorem 2.3 and Theorem 2.4 respectively Sta...

Ngày tải lên: 07/08/2014, 06:22

20 187 0
w