a new holographic in university

Báo cáo y học: "Gain of a 500-fold sensitivity on an intravital MR Contrast Agent based on an endohedral Gadolinium-Cluster-Fullerene-Conjugate: A new chance in cancer diagnostics"

... precision of therapy like the intensity-modulated radiation therapy (IMRT) and the use of heavy ions demands absolute reliability of new diagnostics and treatment planning for prostate and brain ... 14 It was used to investigate whether an intracellular MR imaging is possible and to estimate the T1 relaxivity on MR (1.5 T) Historically already in 1994 electron-spin-resonance and mass-spectrometry ... Okumura M, Mikawa M, Yokawa T, et al Evaluation of water-soluble metallofullerenes as MRI contrast agents Acad Radiol 2002; (Suppl 2): S495-S497 Tang J, Xing G, Zhao F, et al Modulation of structural...

CHAPTER ELEVEN MIND MAPPING a NEW DIMENSION IN THINKING AND NOTE TAKING

... Outlining On page 109 is a Mind Map summarising a three-day Brain Training and Mind Mapping Course The Mind Map was made by a father who was also a company director He used the same Mind Map to ... words or phrases for main and secondary ideas from Kusa-Hibari main secondary paragraph paragraph paragraph paragraph paragraph Below you will find sample key words and phrases from the notes of ... structure of the brain Advanced note taking and mapping techniques 86 NOTING Exercise In the space below, and starting immediately after having reached the end of this paragraph, prepare a half-hour speech...

Tài liệu Báo cáo khoa học: "Discriminative Lexicon Adaptation for Improved Character Accuracy – A New Direction in Chinese Language Modeling" pptx

... 2002 Toward a uniﬁed approach to statistical language modeling for Chinese ACM Transaction on Asian Language Information Processing, 1(1): 3–3 3 Jianfeng Gao, Mu Li, Andi Wu, and Chang-Ning Huang 2004 ... to increase total path probability mass This can be amended by involving the discriminative language model adaptation in the iteration, which results in a uniﬁed language model and lexicon adaptation ... chart in Figure At the beginning we are given an adaptation spoken corpus and manual transcriptions Based on a baseline lexicon (Lex0 ) and a language model (LM0 ) we perform ASR on the adaptation...

Tài liệu Báo cáo Y học: Soluble silk-like organic matrix in the nacreous layer of the bivalve Pinctada maxima A new insight in the biomineralization ﬁeld pptx

... Pereira-Mouries et al (Eur J Biochem 269) Table Glycosaminoglycan analysis and calcium measurements of the water -soluble matrix, the EDTA -soluble matrix and the EDTA-insoluble matrix of Pinctada maxima ... Table Amino acid compositions (mole percent) of the water -soluble matrix, water-insoluble matrix, the EDTA -soluble matrix and the EDTAinsoluble matrix of Pinctada maxima nacre Results are expressed ... shell layer of the pearl oyster P maxima, was extracted by either ultra-pure water or EDTA and then fractionated into soluble and insoluble matrix by centrifugation Demineralization of powdered nacre...

scientific american - 2002 06 - spintronics - a new twist in computing

... +4 9-6 9-7 1-9 1-4 9-0 fax: +4 9-6 9-7 1-9 1-4 9-3 0 Sweden Andrew Karnig & Associates +4 6-8 -4 4 2-7 050 fax: +4 9-8 -4 4 2-7 059 Belgium Publicitas Media S .A +3 2-2 -6 3 9-8 445 fax: +3 2-2 -6 3 9-8 456 Middle East and India Peter ... Thailand are based on a combination of clades B and E, and in April the International AIDS Vaccine Initiative expanded tests of a clade A derived vaccine in Kenya, where clade A is found But in January, ... primates SOUTH CHINA SEA MALAYSIA BORNEO SUMATRA INDONESIA INDIAN OCEAN JAVA Present-Day Orangutan Range HUNDREDS OF THOUSANDS of orangutans roamed throughout Southeast Asia about 10,000 years ago,...

a new dataset in the making

... thank Johanna Bötscher, Martina Castro, Kristina Hauser, Benjamin Hofmann, Theresa Kuhn, Salome Lang, Justin Leinaweaver, Julie Mandoyan, Martiño Rubal Maseda, Claudia Meier, Irina, Mirkina, Katharina ... Percentage 20 25 National treatment no National treatment yes Percentage America Oceania Region 30 Region Africa Europe Asia Africa America Oceania Region Cross Europe Asia Africa America Oceania ... other states From the Foreign Affairs and International Trade Canada website: http://www.international.gc.ca/tradeagreements-accords-commerciaux/agr-acc/index.aspx some information as to planning...

Báo cáo sinh học: " Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseases" doc

... Biochemical Prevention and Treatment via targeting on viral mRNA Targeting viral mRNA is one of the most active areas of research and development Several strategies have emerged over the years and are ... candidates are limited by insufficient efficacy and unfavorable pharmacokinetics MAbs have increasingly gained favor in large part because of the development of chimeric, humanized, and human antibodies ... OraSure Technologies, Inc CytoDyn Amerimmune Pharmaceuticals, Inc TIPRANAVIR AAI International, AnaaiPharma Company MedImmune MedImmune MedImmune Inspire Pharmaceuticals Genital Warts HPV Hepatitis...

báo cáo hóa học: " Intention as an indicator for subjective need: A new pathway in need assessment" doc

... study and at the data acquisition followed by data preparation for the current analysis RP participated at data acquisition and data preparation for the current analysis TU participated in the ... t-1 was used as additional covariate The last analysis was focused on the association between health factors and participation This result has to be taken into account for the discussion of intention ... cohort at baseline t-1 The teachers were informed shortly about the program and procedures by means of a covering letter at baseline and by an informative meeting The coaching program offered was...

báo cáo hóa học:" Biochemical prevention and treatment of viral infections – A new paradigm in medicine for infectious diseases" pdf

Desiccant enhanced evaporative air-conditioning (DEVap): evaluation of a new concept in ultra efficient air conditioning docx

... http://www.simpopdf.com Acronyms and Abbreviations AAHX air- to -air heat exchanger AILR AIL Research A/ C air- conditioning CHP combined heat and power COP coefficient of performance DEVap desiccant- enhanced evaporative ... Merge and Split Unregistered Version - http://www.simpopdf.com Desiccant Enhanced Evaporative Air- Conditioning (DEVap): Evaluation of a New Concept in Ultra Efficient Air Conditioning Eric Kozubal, ... does in building spaces only Today’s A/ C systems: • Maintain a healthy building environment o In commercial and new residential, A/ C provides ventilation air to maintain indoor air quality o A/ C...

Báo cáo y học: "Human depression: a new approach in quantitative psychiatry" pdf

... were particularly involved in data collection and data analysis All authors were involved in the interpretation of the data All the authors have been involved in drafting and revising the manuscript ... manuscript and have read and approved the final manuscript Author Details 1DIMORFIPA, University of Bologna, Italy, 2Faculty of Veterinary Medicine, University of Bologna, Italy, 3Faculty of Human Sciences, ... example, activation of adenylate cyclase) The Gα subunit is activated and starts a cAMP signalling cascade, as shown in Figure The international scientific literature has reported abnormalities in...

Báo cáo y học: " Chemokine blockade: a new era in the treatment of rheumatoid arthritis" ppsx

... migrate to the site of infection), and the potential of inhibiting the migration of cells that are able to produce an array of proinflammatory cytokines at the site of inflammation The identification ... one-third of the patients fulfilled the ACR20% criteria after active treatment 95 Arthritis Research & Therapy Vol No Haringman and Tak The data from studies with chemokine antagonists in humans are at ... Conclusion The available data in animal models and initial data in human disease suggest that chemokine family members might be attractive targets for therapeutic intervention Targeting one specific chemokine...

Báo cáo y học: "Soluble IL-18 receptor complex: a new star in the firmament of rheumatoid arthritis diagnosis" pptx

... activity; the activation and release of IL-18 by the in ammasome as a marker of innate immunity; and the alternatively spliced soluble IL-18Rβ, which is mainly expressed in the lymphoid organs and ... diagnosis of RA The soluble IL-18Rα complex as a biomarker may capture the complexity of the in ammatory process: the shedding of membrane IL-18Rα as a marker of enhanced proteolytic activity; ... Interestingly, IL-18 protein expression in synovial tissue did correlate with serum CRP and disease activity in inﬂammatory arthritis [12], indicating a local role in the pathophysiology of disease A...

Báo cáo y học: "Identification of an endogenous retroviral envelope gene with fusogenic activity and placenta-specific expression in the rabbit: a new "syncytin" in a third order of mammals" ppt

... representation of a rabbit placenta (right) and haematoxylin and eosin staining of a day 12 placenta section (left) with the main layers of the placenta indicated (B) Higher magnification of the areas framed ... Structure and in situ hybridization forand eosin staining of a dayof day 12 rabbit placenta: (A) Schematic representation placenta bit placenta (right) and haematoxylin syncytin-Ory1 expression 12 placenta ... 50°C, at 68°C) The primers used were: 5'TTCCTGAGGGCTCACTGATTAAC and 5'-GAAGGGGAGAGTCAGTTGTTGGAG (external to the ORF) or 5'AGACTGCGGAGATAAAACTGC and 5'-gataaaggtcatcagcctattga (internal to the...

Báo cáo y học: "Bench-to-bedside review: Circulating microparticles - a new player in sepsis" ppt

... of Microparticles as a player in coagulation disorders of sepsis In the defence against pathogens, haemostasis is as fundamentally important as innate immunity and complement-mediated cell lysis ... vitamin-K-dependent factors and phosphatidylserine comprise the key step in this assembly, explaining the eﬃcacy of anti-vitamin K treatments in hypercoagulable states [22] At the monocyte surface ... increasing TF dissemination and thrombotic microangiopathy or disseminated intravascular coagulopathy (B) TF initiation of blood coagulation is quickly down-regulated by tissue factor pathway...

Xem thêm