New bioactive biomaterials based on quaternized chitosan

... 100 words in section 23 using model (3) For 'no lexical information' all estimates are based on POS tags alone For 'no distance measure' the distance measure is Question alone (i.e whether zbj ... backed-off estimation strategy is used for making prepositional phrase attachment decisions The idea is to back-off to estimates based on less context In this case, less context means look...

Ngày tải lên: 08/03/2014, 07:20

... CAGGAAACAGCTATGAC CGGAATTCTGAAGGTGGCCCGCC AGGTGACAG CGCGGATCCAATCTTGATGGGGC AGCCGGAGAGG AGGAYTCTCTGGATAGTGG CTCACCACAGACGATWTCC CGGTAAGCCCATAACGCCCA CAGGCCAGGATTTGCAGCC CATAAACAYGAGCCAGTTGCC GAGTGGATGCACAGTCGTTG ... GAGTGGATGCACAGTCGTTG GAAACGGAGGTAGTGACACAT GCCTGCTCGAATTCGGGATG CTCCTTCTTGCACAAAAAGTG CTGCTCGAATTCGGGATG GTCYGGGTAATTCCTATATA GTGATCGAATTTGGGAAGATGATCCA CCCTTGCATTTAAACCTCAGGTACAC...

Ngày tải lên: 17/03/2014, 03:20

... precision of therapy like the intensity-modulated radiation therapy (IMRT) and the use of heavy ions demands absolute reliability of new diagnostics and treatment planning for prostate and brain ... 14 It was used to investigate whether an intracellular MR imaging is possible and to estimate the T1 relaxivity on MR (1.5 T) Historically already in 1994 electron-spin-resonance...

Ngày tải lên: 26/10/2012, 09:07

... 2.4.1.19 AAP31242 AAB65420 CAA55023 CAA48401 AAG31622 BAB91217 CAA33763 AAA22298 P31835 BAA14289 AAA22308 ALBSX1 AAA22310 AAA22309 CAA46901 BAA31539 AAA22239 CAA01436 Z34466 BAA02380 CAA41770 AAD00555 ... a- amylase amyCrysp a- amylase amyStrgr a- amylase amyStrlm a- amylase amyStrli1 a- amylase amyStrli2 a- amylase amyStrvi a- amylase amyThncu a- amylase amy_Aspaw a- amylase CBM2 0...

Ngày tải lên: 07/03/2014, 21:20

... SMT Language model and paraphrase table Paraphrase generation tools based on SMT methods need a language model and a paraphrase table Both are computed on a training corpus The language models ... propose a variation of the UCT algorithm for paraphrase generation named MCPG for MonteCarlo based Paraphrase Generation The main part of the algorithm is the sam...

Ngày tải lên: 17/03/2014, 02:20

... information contained in each of the selected units was compared and a common conceptual denomination was assigned to the group of segments sharing the same clinical profile as a standard As a next ... of the organizational model of signification is noted and its form of production by means of a typology of elemental relations" These relations are: contradiction, contrar...

Ngày tải lên: 20/06/2014, 00:20

... 1: Parameters of the simulated signal Components (k) Ak ak,1 ak,2 ak,3 π/8 × 10−3 × 10−5 1.5 π/4 −1 × 10−3 −6 × 10−5 ISAR Imaging of Ship Target Based on IHMPT The ISAR imaging algorithm of ship ... multicomponent CPS for ISAR imaging of ship target with high maneuverability In this paper, a new algorithm called IHMPT is proposed to estimate the para...

Ngày tải lên: 21/06/2014, 05:20

... was proposed for the fast recovery of the signal with one snapshot of receiving signals in the presence of mutual coupling, based on 2D D3 LS algorithm for URA Then, utilizing the 2-D D3 LS algorithm ... of the coupling coefficients versus the SNR Conclusion In this paper, the problems of 2-D D3 LS algorithms were studied for recovering of the...

Ngày tải lên: 21/06/2014, 05:20

... used all samples of three famous iris databases, that is, CASIA-IrisV3, Bath, and Ubiris CASIA-IrisV3 includes three subsets which are labeled as CASIA-IrisV3-Interval, CASIA-IrisV3-Lamp, and CASIA-IrisV3-Twins ... USA, September-August 2006 [7] L Ma, T Tan, Y Wang, and D Zhang, “Personal identification based on iris texture analysis,” IEEE Transactions on Pattern Analysis and Machin...

Ngày tải lên: 21/06/2014, 22:20

... modulation (ACM) Then, in this paper, we focus on a subcarrier allocation strategy that is aware of the queuing state per each user and that retains a fixed power allocation as well as adaptive quadrature ... quadrature amplitude modulation (QAM) Subcarrier allocation in OFDMA can be seen as a combinational problem where there are plenty of possible combinations associated to a giv...

Ngày tải lên: 22/06/2014, 00:20

... modulation (ACM) Then, in this paper, we focus on a subcarrier allocation strategy that is aware of the queuing state per each user and that retains a fixed power allocation as well as adaptive quadrature ... quadrature amplitude modulation (QAM) Subcarrier allocation in OFDMA can be seen as a combinational problem where there are plenty of possible combinations associated to a giv...

Ngày tải lên: 22/06/2014, 06:20

... Viberg, “Two new approaches for channel prediction based on sinusoidal modeling,” EURASIP Journal on Applied Signal Processing, special issue on advances in subspace -based techniques for signal ... performance of the sinusoidal modelingbased channel prediction methods depends heavily on the stationarity properties of model parameters in the observation window a...

Ngày tải lên: 22/06/2014, 23:20

... 16 CONCLUSIONS Combining the theory of the visual secret sharing scheme and the viewpoint of the human visual model, this paper proposes a new watermarking scheme to embedding the digital color ... “A digital watermarking scheme using human visual effects,” Informatica, vol 24, no 4, pp 505–511, 2000 [5] C.-C Chang and H C Wu, “A copyright protection scheme of images...

Ngày tải lên: 23/06/2014, 01:20

... Origin of Polish Arabian horses 613 614 I G a ewska et al z Eight haplotypes were each represented in a single dam line All Babolna’s dam lines, Szamrajówka, Selma, and two of four of Sławuta’s ... G a ewska et al z Table I Dam lines in Arabian horses in Poland: founders and main branches of the lines * In brackets: percentage of representatives of the line of b...

Ngày tải lên: 14/08/2014, 13:22

... Morimoto T, Kadoya R, Endo K, Tohata M, Sawada K, Liu S, Ozawa T, Kodama T, Kakeshita H, Kageyama Y, Manabe K, Kanaya S, Ara K, Ozaki K, Ogasawara N: Enhanced recombinant protein productivity by genome ... reaction data (Table S2 in Additional data files and 2), estimated thermodynamic data (Table S2 in Additional data files and 2), model stoichiometry in SBML format (Additional data file...

Ngày tải lên: 14/08/2014, 21:20