Aerobic fitness, physical function and falls among older people a prospective study

Reducing falls among older people in general practice  the proact65+ exercise intervention trial

Reducing falls among older people in general practice the proact65+ exercise intervention trial

... 0.25 in the FaME group, 0.27 in OEP and 0.26 in UC There was no difference between the exercise interventions' falls incidence rate and UC during the intervention (Table 3) The 351 falls in the ... 1.10; p = 0.13) in the combined intervention period and first year postintervention The injurious falls rate was lower in all groups in the second year post...

Ngày tải lên: 25/08/2016, 23:00

9 290 0
Single and dual task tests of gait speed are equivalent in the prediction of falls in older people  a systematic review and meta analysis

Single and dual task tests of gait speed are equivalent in the prediction of falls in older people a systematic review and meta analysis

... ABAK1RABAAP1AB8Yk ABAK1RSABA8P1AB8Yk AB881RSAB8_P1AB_Jk SABAK1RSABYJP1AB8_k AB8J1RSABA3P1AB_Kk ABA_1RSAB8MP1ABYGk SABAY1RSABY8P1AB83k AB881RABAAP1ABYYk ABAJ1RSABA3P1AB8+k ABAK1RSABAGP1AB8+k ABA+1RSABA+P1ABY8k ... ABA+1RSABA+P1ABY8k AB8G1RABA8P1AB_Ak ABAM1RSABAGP1ABY_k AB8+1RABAKP1ABY3k AB8G1RSABAAP1AB_Ak AB8Y1RABA8P1ABY_k ABA31RSABA3P1ABYJk ABY_1RAB8AP1AB_+k ABA31RABAKP1AB88k MB_3 3BAM AB+G 8...

Ngày tải lên: 25/08/2016, 23:09

53 372 0
Frailty as a predictor of future falls among community dwelling older people  a systematic review and meta analysis

Frailty as a predictor of future falls among community dwelling older people a systematic review and meta analysis

... log-transformed upper and lower limits of 95% CI by 3.92 These data of each study were entered into the Review Manager and Comprehensive Meta- Analysis to perform meta- analysis and meta- regression analysis The ... Study of Osteoporotic Fractures frailty index *Sample size of cohort actually used for frailty and fall analysis, or of entire cohort if not avai...

Ngày tải lên: 25/08/2016, 21:28

7 338 0
ocial integration and its association with mortality among older people in china

ocial integration and its association with mortality among older people in china

... Examining the association between social integration and mortality for older people in contemporary China The aim of this thesis is to examine the association between social integration and mortality ... older people in China 2.3 Social and cultural differences in the association between social integration and health for older adults Although the inc...

Ngày tải lên: 10/09/2015, 15:52

317 529 0
Effectiveness of chiropractic care to improve sensorimotor function associated with falls risk in older people  a randomized controlled trial

Effectiveness of chiropractic care to improve sensorimotor function associated with falls risk in older people a randomized controlled trial

... study aimed to investigate this potential relationship by assessing whether usual chiropractic care had an impact on measures of sensorimotor function associated with falls risk in older adults ... that indicated that they may influence the dependent variable that was being analyzed and were included in each model as appropriate All available data were used in the...

Ngày tải lên: 25/08/2016, 19:20

12 354 0
Mild cognitive impairment is associated with falls among older adults  findings from the irish longitudinal study on ageing (TILDA)

Mild cognitive impairment is associated with falls among older adults findings from the irish longitudinal study on ageing (TILDA)

... ACCEPTED MANUSCRIPT Mild cognitive impairment is associated with falls among older adults: findings from the Irish Longitudinal Study on SC R IP T Ageing (TILDA) Stefanos Tyrovolas1,2, ... IP T The prevalence of mild cognitive impairment was 10% in the Irish older population Mild cognitive impairment is related with higher rates o...

Ngày tải lên: 25/08/2016, 22:05

24 265 0
Impact of tai chi on falls among preclinically disabled older people  a randomized controlled trial

Impact of tai chi on falls among preclinically disabled older people a randomized controlled trial

... community based tai- chi trials have a usual care, education, or social activity control group, and not a comparison exercise group as used in our study The effect of tai- chi on falls among community ... performance and early disease J Clin Epidemiol 2001;54:889e901 17 Day L, Hill K, Jolley D, et al Impact of tai- chi on impairment, functional limitation and disabi...

Ngày tải lên: 25/08/2016, 22:35

7 346 0
Implementing the evidence for preventing falls among community dwelling older people  a systematic review

Implementing the evidence for preventing falls among community dwelling older people a systematic review

... implementation in the management of accidental falls among older people (Fig 1) No methods filter was applied The master search strategy was adapted and run in the following electronic databases from ... media awareness campaigns, outreach visits to older people, and patient and provider materials This collaborative approach resulted in improvements in fall-prevention assessme...

Ngày tải lên: 25/08/2016, 22:36

9 331 0
Risk factors for falls in older people in nursing homes and hospitals  a systematic review and meta analysis

Risk factors for falls in older people in nursing homes and hospitals a systematic review and meta analysis

... screening citations and abstracts n=2708 Studies about risk factors for falls in older people n=1447 Excluded because not original studies n=1091 Original studies about risk factors for falls in older ... older people: A systematic review and meta- analysis Epidemiology, 21, 658–668 DerSimonian, R., & Laird, N (1986) Meta- analysis in clinical tr...

Ngày tải lên: 25/08/2016, 23:00

9 387 0
Báo cáo khoa học: A possible physiological function and the tertiary structure of a 4-kDa peptide in legumes potx

Báo cáo khoa học: A possible physiological function and the tertiary structure of a 4-kDa peptide in legumes potx

... the insulin pharmacophore, IleA2-ValA3 at the A- chain N-terminus, TyrA19 at the A- chain C-terminus, and ValB12 and TyrB16 at the B-chain central helix assume essentially the same spatial arrangements ... mutant 4-kDa peptides, and the binding activity of the mutant 4-kDa peptides to the 43-kDa protein was detected with anti- (4-kDa peptide) Ig Ligand: (A) nor...

Ngày tải lên: 31/03/2014, 07:20

8 386 0
Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx

Báo cáo y học: "Thymic function and T cell parameters in a natural human experimental model of seasonal infectious diseases and nutritional burden" potx

... CGGTTTGTTTGGGTTTGG GTTTGGGTTTGGGTTTGGGTT (forward) and GGC TTGCCTTACCCTTACCCTTACCCTTACCCTTACC CT (reverse), were used to amplify telomeric DNA in the CD4+ and CD8+ T cell subset Six serial dilutions ... doi:10.1186/1423-0127-18-41 Cite this article as: Ngom et al.: Thymic function and T cell parameters in a natural human experimental model of seasonal infe...

Ngày tải lên: 10/08/2014, 05:21

11 527 0
báo cáo khoa học: "Goal conflict, goal facilitation, and health professionals’ provision of physical activity advice in primary care: An exploratory prospective study" pot

báo cáo khoa học: "Goal conflict, goal facilitation, and health professionals’ provision of physical activity advice in primary care: An exploratory prospective study" pot

... this article as: Presseau et al.: Goal conflict, goal facilitation, and health professionals’ provision of physical activity advice in primary care: An exploratory prospective study Implementation ... We hypothesised that goal facilitation and goal conflict would predict health professional behaviour over and above intention and PBC Page of gi...

Ngày tải lên: 10/08/2014, 11:20

9 318 0
Báo cáo y học: "Benzodiazepine Use and Misuse Among Patients in a Methadone Program" potx

Báo cáo y học: "Benzodiazepine Use and Misuse Among Patients in a Methadone Program" potx

... estimate the prevalence of BZD use and misuse among patients in a methadone program, and the survey revealed a prevalence of 47% lifetime use of BZD among our methadone- maintained patients, and ... the changing demographics and patterns of drug use Gelkopf et al [22] examined BZD abuse in methadone maintenance patients in a one-year prospective study...

Ngày tải lên: 11/08/2014, 15:22

7 334 0
Từ khóa:
w