The 3d kinematics of the single leg flat and decline squat

Chapter 6 The Single Index Model and Bivariate Regression

Chapter 6 The Single Index Model and Bivariate Regression

... 2,M and εpt = x1 ε1t + x2 ε2t Hence, the single index model will hold for the return on the portfolio where the parameters of the single index model are weighted averages of the parameters of the ... included in the regression The standard deviation of the residuals is essentially equal to the standard error of the regression - the difference being d...

Ngày tải lên: 17/12/2013, 15:17

20 495 0
THE CONTRIBUTION OF CLAMS ON TIDAL FLAT PURIFICATION CAPACITY

THE CONTRIBUTION OF CLAMS ON TIDAL FLAT PURIFICATION CAPACITY

... DISCUSSION Diurnal variation of DOC concentration The diurnal variation of DOC concentration in pore water of tidal flat sediments with and without clams is shown in Fig Concentration of DOC in tidal ... organic matters in tidal flat sediment Moreover, nitrate removal capacity of tidal flat sediments with and without clams was also studied to clarify the con...

Ngày tải lên: 05/09/2013, 09:08

8 355 0
Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx

Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx

... interior of the protein matrix The script a is the peak–peak distance between the maximum at %287 nm and the minimum at %283 nm, and the script b is the peak–peak distance between the maximum at %295 ... are the experimentally determined numerical values of the ratio a/ b, and is the theoretical numerical value of ratio a/ b for a mixture of a...

Ngày tải lên: 21/02/2014, 00:20

12 550 0
Tài liệu Báo cáo Y học: Phosphatidylinositol synthesis and exchange of the inositol head are catalysed by the single phosphatidylinositol synthase 1 from Arabidopsis docx

Tài liệu Báo cáo Y học: Phosphatidylinositol synthesis and exchange of the inositol head are catalysed by the single phosphatidylinositol synthase 1 from Arabidopsis docx

... the reverse products and shown that the CMP activation of the reverse of synthesis is by a different mechanism from base exchange [20] Further analysis of the products released from PtdIns by ... between the two sets of PtdIns molecules: the C16:0/C17c + C18 :1/ C17c and C16:0/C19c peaks are characteristic of E coli (A.-M Justin, unpublished data) where...

Ngày tải lên: 22/02/2014, 04:20

6 552 0
REPORT OF THE SINGLE AUDIT OF THE LOUISVILLE/JEFFERSON COUNTY METRO GOVERNMENT: CRIT LUALLEN AUDITOR OF PUBLIC ACCOUNTS pptx

REPORT OF THE SINGLE AUDIT OF THE LOUISVILLE/JEFFERSON COUNTY METRO GOVERNMENT: CRIT LUALLEN AUDITOR OF PUBLIC ACCOUNTS pptx

... Louisville Metro Council As Auditor of Public Accounts, I am pleased to transmit herewith our report of the Single Audit of the Louisville/Jefferson County Metro Government (Metro Government) for the ... On behalf of the Office of Financial Audit of the Auditor of Public Accounts, I wish to thank the employees of Metro Government for th...

Ngày tải lên: 15/03/2014, 23:20

212 416 0
Báo cáo khoa học: Interaction of the C1 complex of Complement with sulfated polysaccharide and DNA probed by single molecule fluorescence microscopy pdf

Báo cáo khoa học: Interaction of the C1 complex of Complement with sulfated polysaccharide and DNA probed by single molecule fluorescence microscopy pdf

... contains the binding site of DNA, we wondered whether the association of the tetramer C1r2– C1s2 to C1q could interfere with the binding of C1q to DNA We studied the binding to DNA of the C1 complex ... compete with purified C1q* for the binding to DNA When incubation of T4 DNA and C1q* was performed with various amounts of CLR, the analysis of...

Ngày tải lên: 16/03/2014, 23:20

7 395 0
Báo cáo khoa học: End-damage-specific proteins facilitate recruitment or stability of X-ray cross-complementing protein 1 at the sites of DNA single-strand break repair docx

Báo cáo khoa học: End-damage-specific proteins facilitate recruitment or stability of X-ray cross-complementing protein 1 at the sites of DNA single-strand break repair docx

... include identification of these lesions as a strand break, verification of the nature of the 3¢ end, and identification of a satisfactory pathway for repair The XRCC1 component of the XRCC1 DNA ligase ... period Approximately 80% of the repair of the substrate is achieved within at a point where the proteins are dissociating from the DNA Therefore, cross...

Ngày tải lên: 23/03/2014, 11:20

11 299 0
Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

Báo cáo khoa học: A strategy for the generation of specific human antibodies by directed evolution and phage display An example of a single-chain antibody fragment that neutralizes a major component of scorpion venom docx

... City, CA, USA) Isolation of anti-Cn2 scFv by panning of phage- antibody repertories The library of human scFv was displayed on filamentous phage and used for the selection of antibodies against ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTAATTTTATGCTGACTCAGCCCCA CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTGCC CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTG...

Ngày tải lên: 23/03/2014, 13:20

11 680 0
báo cáo hóa học:" Alendronate (ALN) combined with Osteoprotegerin (OPG) significantly improves mechanical properties of long bone than the single use of ALN or OPG in the ovariectomized rats" pdf

báo cáo hóa học:" Alendronate (ALN) combined with Osteoprotegerin (OPG) significantly improves mechanical properties of long bone than the single use of ALN or OPG in the ovariectomized rats" pdf

... properties in addition to the bone mass Since the mechanical testing is the current golden standard for accessing bone quality, the data suggested that the combined use of OPG- Fc and ALN in the ... with Osteoprotegerin (OPG) significantly improves mechanical properties of long bone than the single use of ALN or OPG in th...

Ngày tải lên: 20/06/2014, 04:20

8 414 0
báo cáo hóa học:" Alendronate (ALN) combined with Osteoprotegerin (OPG) significantly improves mechanical properties of long bone than the single use of ALN or OPG in the ovariectomized rats" pot

báo cáo hóa học:" Alendronate (ALN) combined with Osteoprotegerin (OPG) significantly improves mechanical properties of long bone than the single use of ALN or OPG in the ovariectomized rats" pot

... properties in addition to the bone mass Since the mechanical testing is the current golden standard for accessing bone quality, the data suggested that the combined use of OPG- Fc and ALN in the ... with Osteoprotegerin (OPG) significantly improves mechanical properties of long bone than the single use of ALN or OPG in th...

Ngày tải lên: 20/06/2014, 07:20

8 392 0
Báo cáo hóa học: " The Microscopic Origin of Residual Stress for Flat Self-Actuating Piezoelectric Cantilevers" doc

Báo cáo hóa học: " The Microscopic Origin of Residual Stress for Flat Self-Actuating Piezoelectric Cantilevers" doc

... using the SigmaPlot R software (Ver10, Systat Software Inc) The positive values in the microstress profile indicate that all of the microstresses 160 140 Residual stress (MPa) reliable operation of ... line of an argon ion laser was used as the excitation source and calibrated using a silicon sample before measuring the PZT films For the macrostress analysis, the r...

Ngày tải lên: 21/06/2014, 11:20

6 225 0
Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc

Báo cáo hóa học: " Influences of H on the Adsorption of a Single Ag Atom on Si(111)-7 3 7 Surface" doc

... the H atom at the Si adatom removes toward the adsorbed Ag atom and forms a covalent-like Ag -H bond Due to the charge transfer from the H to the Si adatom on the 1 9H- Si(111 )7 surface, the H atom ... transfer toward the Si adatom when the H sits on the Si adatom There is a strong covalent bond between the H and the Si rest atom when...

Ngày tải lên: 22/06/2014, 00:20

6 368 0
Báo cáo hóa học: " Characterization and Optical Properties of the Single Crystalline SnS Nanowire Arrays" pot

Báo cáo hóa học: " Characterization and Optical Properties of the Single Crystalline SnS Nanowire Arrays" pot

... region The direct energy gap Eg of the SnS nanowires has been calculated as 1.59 eV, and this experimental optical band gap value is the evidence for the quantum confinement of the SnS nanowires ... images of AAO template and SnS nanowire arrays a The sample was etched for 10 h b The SnS nanowires with a diameter of about 50 nm c The SAED pattern taken f...

Ngày tải lên: 22/06/2014, 01:20

5 317 0
Báo cáo hóa học: " Stretching and immobilization of DNA for studies of protein–DNA interactions at the single-molecule level" ppt

Báo cáo hóa học: " Stretching and immobilization of DNA for studies of protein–DNA interactions at the single-molecule level" ppt

... end of the DNA; then the DNA molecule is stretched out by the force exerted on the rest of the DNA by the receding meniscus; and finally the other end also sticks to the substrate as it dries The ... between ssDNA and dsDNA The stretching force is increased to 50 pN to separate the newly synthesized strand from the template strand by destabilizing the...

Ngày tải lên: 22/06/2014, 18:20

17 351 0
Báo cáo hóa học: "Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" pdf

Báo cáo hóa học: "Synthesis of SnS nanocrystals by the solvothermal decomposition of a single source precursor" pdf

... promote the decomposition reaction of metal alkyl xanthates, thiocarbamates and thiocarbonates at relatively low temperatures Indeed, the heating of the reaction mixture without amines at elevated ... accurate for polydisperse solutions of nanoparticles, these reported bandgap values should be taken as approximate The increased values of band gap for SnS NCs compared with...

Ngày tải lên: 22/06/2014, 22:20

5 365 0
Từ khóa:
w