... Change in clinical paradigm Definitions of coeliac disease New diagnostic guidelines Algorithms Interlaken ESPGHAN criteria (1979) Small intestinal biopsy: villous atrophy Gluten free diet for 1-2 ... unpublished Towards a new definition of coeliac disease Chronic Multi-organ Small intestinal inflammation Transglutaminase-related ESPGHAN working group, 2011 S...
Ngày tải lên: 22/03/2014, 09:20
... contrast to the sequence of intervention mapping steps, the evaluation design was already defined by the start of the European project The process evaluation was developed by the main coordinating ... during the second face -to- face meeting in November 2007 and finilised by the beginning of 2008 (Table 1) In January 2008, a central training was organised...
Ngày tải lên: 14/08/2014, 08:20
Guidelines for the determination of brain death in infants and children
... Guidelines for the Determination of Brain Death in Infants and Children Critical Care Medicine 2011;39:2139–2155 Nakagawa TA, Ashwal SA, Mathur M, Mysore M Guidelines for the Determination of Brain Death ... for determination of brain death in children American Academy of Pediatrics Task Force on Brain Death in Children Pediatrics 19...
Ngày tải lên: 14/11/2016, 06:25
Báo cáo hóa học: " Effect of ion implantation energy for the synthesis of Ge nanocrystals in SiN films with HfO2/SiO2 stack tunnel dielectrics for memory application" pot
... minimize the H content in the films Ion implantation in these stack layers were carried out with 7 4Ge+ ions using GeH4 gas source for the extraction of Ge The Ge+ ion implantation was carried out ... annealing condition The dependence of implantation energy for the formation and evolution of Ge- NCs in these stack structures were studied fu...
Ngày tải lên: 21/06/2014, 05:20
Báo cáo y học: "A unified framework of immunological and epidemiological dynamics for the spread of viral infections in a simple network-based population" ppt
... in parameter values and Variations accumulated viral load their effect on the populaVariations in parameter values and their effect on the population-wide accumulated viral load Additional parameter ... The accumulated mean viral load, Av (t), in the population was the integral of the mean viral load from the beginning of a given simulation (time 0) until...
Ngày tải lên: 13/08/2014, 16:21
Báo cáo sinh học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pdf
... Reference gene selection for quantitative real- time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomegalovirus infections Virol ... of cell types infected with a variety of strains of HIV-1, HSV-1, VZV and cytomegalovirus (CMV) compared to mock infected cells Results A range of...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Determination of suitable housekeeping genes for normalisation of quantitative real time PCR analysis of cells infected with human immunodeficiency virus and herpes viruses" pot
... Reference gene selection for quantitative real- time PCR analysis in virus infected cells: SARS corona virus, Yellow fever virus, Human Herpesvirus-6, Camelpox virus and Cytomegalovirus infections Virol ... of cell types infected with a variety of strains of HIV-1, HSV-1, VZV and cytomegalovirus (CMV) compared to mock infected cells Results A range of...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" High Prevalence of Hepatitis B Virus Markers in Romanian Adolescents With Human Immunodeficiency Virus Infection" ppt
... of < /b> children in both groups and compared with the presence of < /b> protective titers of < /b> anti-HBs antibodies at baseline Seven out of < /b> 35 (20%) HIV-infected adolescents vaccinated against hepatitis < /b> B ... the course of < /b> HBV infection In this study we report the prevalence < /b> of < /b> HBV infection markers in a cohort of < /b> 161 HIV-infecte...
Ngày tải lên: 20/06/2014, 08:20
Báo cáo y học: " Prevalence of GB virus type C in urban Americans infected with human immunodeficiency virus type 1" ppsx
... http://www.retrovirology.com/content/2/1/38 CCGACGCCTATCTAAGTA GACGC and GBVR1 5'TCAACTCGCCGGATAAACCTATTGG Primers for the second-round PCR were GBVF2 5'-GTGACAGGGTTGGTAGG and GBVR2 5'-GACATTGAAGGGCGACGTGG PCR products ... immunodeficiency virus- infected patients J Infect Dis 2003, 187:504-507 Further longitudinal studies will be necessary in HIV- 1infected patients to clarify the po...
Ngày tải lên: 13/08/2014, 09:21
Tài liệu Guidelines for the Management of Inflammatory Bowel Disease (IBD) in Children in the United Kingdom pdf
... s.mitton@sgul.ac.uk Guidelines for the Management of Inflammatory Bowel Disease (IBD) in Children in the United Kingdom Index Introduction Inflammatory Bowel Disease Management of Crohn’s Disease Management of ... Associated aspects of IBD Service Delivery Guidelines for the Management of Inflammatory Bowel Disease (IBD) i...
Ngày tải lên: 12/02/2014, 11:20
Tài liệu "Promoting healthy diets and physical activity: a European dimension for the prevention of overweight, obesity and chronic diseases" doc
... obesity and chronic diseases” I STATE OF PLAY AT EUROPEAN LEVEL I.1 Unhealthy diets and lack of physical activity are the leading causes of avoidable illness and premature death in Europe, and the ... a common forum for action the European Platform for Action on Diet, Physical Activity and Health was launched in March 2005 The Platform brings togeth...
Ngày tải lên: 14/02/2014, 13:20
Tài liệu Guidelines for the appointment of General Practitioners with Special Interests in the Delivery of Clinical Services pdf
... arrangements, including links with others working in the same clinical area in primary care, at PCT level and in acute trusts The GPwSI will be accountable to the PCT Board with clinical responsibility ... Skilled at training health care professionals and Special interest Evidence of working under direct supervision with a specialist clinician in relevant clinical...
Ngày tải lên: 14/02/2014, 21:20
Protecting New Health Facilities from Natural Disasters: Guidelines for the Promotion of Disaster Mitigation potx
... Protecting New Health Facilities from Natural Disasters: Guidelines for the Promotion of Disaster Mitigation O S A LU T E PR Produced by Tarina García Concheso, based on Guidelines For Vulnerability ... country’s health care network The Guidelines for Vulnerability Reduction in the Design of New Health Facilities • Characteristics of the...
Ngày tải lên: 06/03/2014, 00:22
Guidelines for the Investigation of Contacts of Persons with Infectious Tuberculosis Recommendations from the National Tuberculosis Controllers Association and CDC pptx
... Control and Prevention Guidelines for the investigation of contacts of persons with infectious tuberculosis; recommendations from the National Tuberculosis Controllers Association and CDC, and Guidelines ... Sponsored by CDC Guidelines for the Investigation of Contacts of Persons with Infectious Tuberculosis Recommendations...
Ngày tải lên: 06/03/2014, 04:20