Anatomy and Function of a Gene: Dissection Through Mutation (cont)
... mutagenic chemicals Cells have evolved a number of enzyme systems that repair DNA and thus minimize mutations Mutations are the raw material of evolution Although some mutations may confer a selective ... of an autosomal gene VNU-University of Science - DNThai Alkaptonuria: An inborn error of metabolism The biochemical pathway in humans that degrades phenylalanine and tyrosi...
Ngày tải lên: 15/06/2017, 20:38
... – bacteria – Used at replication forks that stalled because of unrepaired DNA damage – "Sloppy" DNA polymerase used instead of normal polymerase – Adds random nucleotides opposite damaged bases ... DNThai General observations of mutation rates • Mutations affecting phenotype occur very rarely • Different genes mutate at different rates • Rate of forward mutation is almost always h...
Ngày tải lên: 15/06/2017, 20:37
... Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Alphaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, Betaproteobacteria Proteobacteria, ... Betaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria, Gammaproteobacteria Proteobacteria...
Ngày tải lên: 07/03/2014, 00:20
Báo cáo Y học: Cloning, expression and characterization of a gene encoding nitroalkane-oxidizing enzyme from Streptomyces ansochromogenes pot
... this gene was designated naoA (nitroalkane-oxidizing enzyme gene) Expression of naoA in E coli To study the function of the naoA gene, it is necessary to obtain an adequate amount of NaoA protein ... recombinant NaoA after Sephadex G75 chromatography; lane 5, purified recombinant NaoA after DEAE-Sepharose Fast Flow chromatography; lane 6, standard molecular mass markers (phospho...
Ngày tải lên: 31/03/2014, 08:20
Design and Implementation of a Three-Phase Induction Motor Control Scheme
... processes and variables are modelled mathematically Furthermore, the MATLAB program can convert a MATLAB design into a C-code design in a relatively straightforward manner Hence, this stage of the ... two-phase currents to generate a means of instantaneously controlling the torque and flux Field-orientated controllers require control of both magnitude and phase of...
Ngày tải lên: 27/10/2013, 23:15
báo cáo hóa học: " The design and testing of a novel mechanomyogram-driven switch controlled by small eyebrow movements" docx
... work was supported in part by an Ontario Graduate Scholarship, Natural Sciences and Engineering Research Council of Canada and the Canada Research Chairs program The authors acknowledge Mr Ka Lun ... the manuscript TC conceived the study, advised on the design and coordination of the experiments, and edited the manuscript All authors read and approved the fin...
Ngày tải lên: 19/06/2014, 08:20
Design and development of a self balancing bicycle using control moment gyro
... moment gyro (CMG) as an actuator The control moment gyro (CMG) is typically used in a spacecraft to orient the vessel [5] Appling a CMG as an actuator to balance a bicycle is a creative and novel approach; ... provides a comparison of the various methods to balance a bicycle, evaluated their advantages and disadvantages The most significant contribution of thi...
Ngày tải lên: 02/10/2015, 17:14
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
... gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA ... taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg I L K K C R R D S D C P G A acgtaaacggcgccgttgccgataacgccgattgagctcggc tgcatttgccgcggcaacggctattgcggctaactc...
Ngày tải lên: 12/02/2014, 10:20
Tài liệu Báo cáo khoa học: a-Conotoxins as tools for the elucidation of structure and function of neuronal nicotinic acetylcholine receptor subtypes doc
... domain of each subunit contributes to the formation of the hydrophilic pore ACh binding protein has structural and functional homology to the extracellular ligand binding domain of the nAChR, and ... development of selective drugs is the identification and pharmacological characterization of the various receptor subtypes, and the determination of their prec...
Ngày tải lên: 19/02/2014, 12:20
Báo cáo khoa học: Proteolytic activation and function of the cytokine Spatzle in the innate immune response of a lepidopteran insect, Manduca sexta ppt
... C An et al Manduca sexta Spatzle ¨ Introduction A prominent feature of the innate immune systems of insects is the activation of serine proteinase cascade pathways in hemolymph, which function ... gene In the clade including Spatzle- 1, the branch lengths are noticeably longer and ¨ the bootstrap values are lower than in the other clades containing...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo Y học: Identification and characterization of a new gene from Variovorax paradoxus Iso1 encoding N -acyl-D-amino acid amidohydrolase responsible for D-amino acid production pdf
... towards N- acetyl-D-methionine, N- acetyl-D-alanine, N- acetyl-D-leucine and N- chloroacetyl-D-phenylalanine than towards N- acetyl-D-valine, N- acetyl-D-phenylalanine, N- acetyl-D-tryptophan, N- acetyl-D-tyrosine ... A- 6-D50061: Alcaligenes xylosoxydans ssp xylosoxydans A- 6 N- acylD-glutamate amidohydrolase; Alicaligenes faecalis-DA1: Alcaligenes faecalis DA1 N- acyl D-amino...
Ngày tải lên: 08/03/2014, 16:20
Báo cáo khóa học: S-(2,3-Dichlorotriazinyl)glutathione A new affinity label for probing the structure and function of glutathione transferases potx
... partial active enzyme intermediate, and kfast and kslow are A nity labelling of maize GST I (Eur J Biochem 271) 3505 the rate constants for the slow and fast phase of the reaction Analysis was ... B-factors of Met121 at ˚ ˚ the A and B chains are 26.67 A2 and 49.26 A2 , and the ˚ and 79.30 A2 , respect˚ B-factors of S atoms are 38.14 A ively It is the...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx
... alkaline phosphatase Materials and methods Bacterial identification and culture conditions DNA manipulation and sequence analysis Plasmid DNA preparation, purification of DNA from agarose gel, and restriction ... TACAAT TATAAT TAAAAT TACTAT TATAAT TAATTT TATAAT TATAAT + – – + – + + CIRCE – This work [10] [9] [61] [62] [63] [38] [64] [37] Fig SDS/PAGE analysis of expression and...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: Cloning, characterization and localization of a novel basic peroxidase gene from Catharanthus roseus potx
... AY032675 DQ650638 AY206412 AY206413 AF244923 NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA NA At5g40150 NA NA NA NA NA NA NA NA NA NA NA NA At5g05340 NA NA NA NA NA NA NA NA NA Unpublished Unpublished ... retrieved from the NCBI database, i.e Avicennia (BAB16317), Nicotiana secretory peroxidases (AAD33072), cotton (COTPROXDS) (AAA99868), barley grain (BP1) (AAA32973), Ar thaliana (ATP 2A) A...
Ngày tải lên: 23/03/2014, 09:21