... operation of combining is obtained by choosing two elements within the survivors and by genetically combining them The genetic combination is a numerical operation that can be performed in many ... Engineering (EEE) of the University of Adelaide under a postdoctoral contract, and the Department of Information Technology and Electrical Engineering (ITEE) of the University...
Ngày tải lên: 22/06/2014, 23:20
... 32 4.1 Multi- objective Optimization 32 ii 4.2 Multi- objective Genetic Algorithms 35 4.2.1 Genetic Algorithms 35 4.2.2 Multi- Objective Genetic Algorithms ... Problem P2 solve the multiobjective optimization problem of improving the flight schedule by using multiobjective genetic algorithms (MOGA), which are the combinations of genetic algorithms (GA) and ... to multi-...
Ngày tải lên: 26/11/2015, 13:03
Bơm ECD-V - P - Composition and Construction of ECD-V3 Pump System
... 2 Operation of ECD-V3 Pump 2-1 Fuel Suction and Injection The mechanism for the suction and pumping/distribution of the fuel is basically the same as for the previous distributor type pump However, ... between the pressure chamber and pump chamber The pressurized fuel spills into the pump chamber, thus decreasing the pressure in the pressure chamber and ending the pump...
Ngày tải lên: 23/10/2012, 09:09
API 2510 – 2001 design and construction of LPG installations
... Design and Construction of LPG Installations Downstream Segment API STANDARD 2510 EIGHTH EDITION, MAY 2001 American Petroleum Institute Helping You Get The Job Done Right~M SPECIAL NOTES API ... FITTINGS, AND OPTIONAL EQUIPMEN 21 Minimum Horizontal Distance Between Shell of Pressurized LPG Tank and Line of Adjoining Property That May Be Developed Design and...
Ngày tải lên: 27/03/2014, 14:08
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot
... end of a signal peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA-3¢ (number 2), were used In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers containing, ... the N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGT...
Ngày tải lên: 30/03/2014, 13:20
Báo cáo hóa học: " Research Article Analysis and Construction of Full-Diversity Joint Network-LDPC Codes for Cooperative Communications" pdf
... in terms of the information bits 1i1 and 2i1 (used for encoding at S1 ), and 1p2 in terms of the information bits 1i2 and 2i2 (used for encoding at S2 ) The first two set of rows 1c and 2c are ... straightforward extension of full-diversity codes for the block fading channel [22].) S1 transmits 1i1 and 1p1 , S2 transmits 1i2 and 1p2 , and the common relay first t...
Ngày tải lên: 21/06/2014, 17:20
Báo cáo hóa học: " Fabricating colloidal crystals and construction of ordered nanostructures" pptx
... illustration of lift-up soft lithography (I) and lCP (II) of colloidal crystals 123 50 Nanoscale Res Lett (2006) 1:46–56 Fig (I, II) SEM images of 2D and 3D patterned colloidal crystals fabricated ... arrays of colloidal microspheres Fig Schematic illustration of the procedure for fabricating 2D ncp array of microspheres SEM images of the patterned 2D colloidal...
Ngày tải lên: 22/06/2014, 22:20
Báo cáo khoa học: " Characterization of untranslated regions of the salmonid alphavirus 3 (SAV3) genome and construction of a SAV3 based replicon" ppsx
... GGCGCGCCTTACTTGTACAGCTCGTCCATGC TCTAGACCAACCACCGGTGCCACCATGGTGAGCAAG GGGGAGCTCGCTAGCTGGATTTATCCTGATGAGTCCGTGAGGACG AAACTATAGGAAAGGAATTCCTATAGTCGATAAATCCAAAAGC CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG ... CCCGCCGGCGGAGGGGTTAGCTGTGAGATTTTGCATCATTGATATATG TATGCTTTTGGATTTATCGACTATAGGAATTCCTT CCGCGGCCGCTCTAGAT25ATTGAAAATTTTAAAAACC CCGCGGCCGCTCTAGAT23ATATTGAAAATTTTAAAACC EcoRI 3HHribo2 NotI...
Ngày tải lên: 12/08/2014, 04:20
Báo cáo sinh học: "Genetic interaction between sire and population of mates in Drosophila melanogaster" pps
... with progeny testing, offsetting the benefits of increased selection accuracy Estimations revealed that in most cases a DISCUSSION Genetic interaction between sire and partner population has been ... of crossbred performance (h!) The parameters the different means by which the interaction may be in one case, as a change in the ranking of sires, or in another, as a di...
Ngày tải lên: 14/08/2014, 19:22
BS 5588 4 1978 fire precautions in the design and construction of buildings MVAC
... Copy, © BSI BS 5588- 4: 1978 Figure — Steps in obtaining the equivalent resistance of a combination of series and parallel paths of air leakage 12 © BSI 01-1999 BS 5588- 4: 1978 For combinations of series ... and construction of buildings BS 5588- 1, Residential buildings BS 5588- 1.1, Code of practice for single-family dwelling houses3) BS 5588-...
Ngày tải lên: 28/09/2014, 23:27
BS 5588 4 1978 fire precautions in the design and construction of buildings—MVAC
... Copy, © BSI BS 5588- 4: 1978 Figure — Steps in obtaining the equivalent resistance of a combination of series and parallel paths of air leakage 12 © BSI 01-1999 BS 5588- 4: 1978 For combinations of series ... Copy, © BSI Foreword This new code of practice was prepared under the direction of the Fire Standards Committee In addition to the existing BS...
Ngày tải lên: 28/09/2014, 23:27
BS 5588 5 1991 fire precautions in the design and construction of buildings firefighting
... affect the extent of firefighting shafts and of the firefighting lifts and stairs in them The minimum extent of firefighting lifts and stairs is shown in Figure In tall buildings and buildings ... Use of this code Section Planning and construction Firefighting shafts Firefighting stairs 14 Firefighting lobbies 14 Fire mains and landing valve...
Ngày tải lên: 28/09/2014, 23:28
commentary on design and construction of reinforced concrete chimneys (aci 307-98)
... Concrete Institute 307-69 Specification for the Design and Construction of Reinforced Concrete Chimneys 307-88 Standard Practice for the Design and Construction of Cast-in-Place Reinforced Concrete ... Concrete Chimneys 318 Building Code Requirements for Structural Concrete 505-54 Standard Specification for the Design and Construction of Reinforced...
Ngày tải lên: 24/10/2014, 15:45
commentary on standard practice for design and construction of concrete silos and stacking tubes for storing gran
... determined by test and the values shown used with caution See Commentary on Section 4.4.1 COMMENTARY ON DESIGN AND CONSTRUCTION OF CONCRETE SILOS AND STACKING TUBES 313R-9 Fig 4-D—Flow chart for selecting ... for computing these bending moments COMMENTARY ON DESIGN AND CONSTRUCTION OF CONCRETE SILOS AND STACKING TUBES 313R-17 Fig 7-A For...
Ngày tải lên: 24/10/2014, 15:45