IAS 36 Impairment of Assets

Application of IAS 36  Impairment of fixed assets

Application of IAS 36 Impairment of fixed assets

... impairment of fixed assets and concretely shows challenging areas for companies within IAS 36 in practice We want to increase the understanding about impairment of fixed assets according to IAS ... however impairment of fixed assets is still an interesting area It can be perceived that valuation of fixed assets is not as problematic as valuation of intang...
Ngày tải lên : 15/04/2017, 19:56
  • 42
  • 346
  • 0
Management ownership structure, audit quality and impairment of assets--evidence from China

Management ownership structure, audit quality and impairment of assets--evidence from China

... of Audit Quality in China 1.2 Objectives of the Thesis 1.3 Contributions of the Thesis 10 1.4 Organization of the Thesis 11 Chapter State Ownership, Audit Quality and Earnings Management in China ... me; And as You did not lose them in the giving, so I not lose them in the return." Management Ownership Structure, Audit Quality and Impairment of Asset...
Ngày tải lên : 01/06/2014, 14:02
  • 259
  • 335
  • 0
Tài liệu Chuẩn mực kế toán quốc tế IAS 36 pptx

Tài liệu Chuẩn mực kế toán quốc tế IAS 36 pptx

... APPROVAL OF IAS 36 BY THE BOARD BASIS FOR CONCLUSIONS DISSENTING OPINIONS ILLUSTRATIVE EXAMPLES © IASCF 1671 IAS 36 International Accounting Standard 36 Impairment of Assets (IAS 36) is set out ... applied for that earlier period Withdrawal of IAS 36 (issued 1998) 141 1708 This Standard supersedes IAS 36 Impairment of Assets (issued in 1998) © IASCF IAS 36 Appendix A U...
Ngày tải lên : 20/01/2014, 18:20
  • 155
  • 2.5K
  • 11
Báo cáo khoa học: Haptoglobin binds the antiatherogenic protein apolipoprotein E – impairment of apolipoprotein E stimulation of both lecithin:cholesterol acyltransferase activity and cholesterol uptake by hepatocytes pdf

Báo cáo khoa học: Haptoglobin binds the antiatherogenic protein apolipoprotein E – impairment of apolipoprotein E stimulation of both lecithin:cholesterol acyltransferase activity and cholesterol uptake by hepatocytes pdf

... triplicate The data are reported as percentage of the value obtained by incubation of Hpt alone, and expressed as mean ± SEM A single representative of at least three independent experiments is ... respectively After incubation, the cell were lysed for measurement of their radioactivity and protein concentration The amount of cholesterol internalized by the cel...
Ngày tải lên : 07/03/2014, 00:20
  • 14
  • 445
  • 0
Báo cáo khoa học: Thrombin-mediated impairment of fibroblast growth factor-2 activity doc

Báo cáo khoa học: Thrombin-mediated impairment of fibroblast growth factor-2 activity doc

... signal after 120 of incubation The strong loss of function and loss of integrity observed after 60 of incubation agree with the almost complete inhibition of mitogenic activity of FGF (Fig 1B) ... parallels the functional impairment of FGF-2 in the presence of different time points of thrombin incubation Structural impairment is expressed as time-dependent decrease of...
Ngày tải lên : 16/03/2014, 01:20
  • 13
  • 345
  • 0
Báo cáo khoa học: Modular kinetic analysis reveals differences in Cd2+ and Cu2+ ion-induced impairment of oxidative phosphorylation in liver pot

Báo cáo khoa học: Modular kinetic analysis reveals differences in Cd2+ and Cu2+ ion-induced impairment of oxidative phosphorylation in liver pot

... Three -modular kinetic analysis of effects of Cd2+ and Cu2+ ions on oxidative phosphorylation Bimodulular kinetic analysis of the effects of Cd2+ and Cu2+ ions on oxidative phosphorylation To determine ... Effect of Cd2+ and Cu2+ ions on the kinetics of the CoQ-reducing and CoQoxidizing modules Effect of Cd2+ on the kinetics of the CoQ-ox...
Ngày tải lên : 16/03/2014, 02:20
  • 13
  • 419
  • 0
Báo cáo khoa học: Impairment of mitochondrial function by minocycline pptx

Báo cáo khoa học: Impairment of mitochondrial function by minocycline pptx

... matrix Mg2+ Depletion of Mg2+ from RLM could be explained by the high lipophilicity of MC (chloroform ⁄ water partition coefficient of 30 at pH 7.4 [24]) and the ability of MC to chelate bivalent ... propose that MC impairs the function of isolated mitochondria by two distinct mechanisms: (a) it depletes mitochondria of endogenous Mg2+, thereby inducing permeability of the...
Ngày tải lên : 30/03/2014, 02:20
  • 10
  • 473
  • 0
Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf

Báo cáo hóa học: " Impairment of the CD8+ T cell response in lungs following infection with human respiratory syncytial virus is specific to the anatomical site rather than the virus, antigen, or route of infection" pdf

... administered either by the IN or ID route IN inoculation of mice with the WR strain of VV has been shown to cause respiratory tract infection followed by dissemination of the virus to various visceral ... it is not the virus bearing the epitope nor local virus replication that results in the decreased functionality of CD8+ CTL in lungs, but...
Ngày tải lên : 20/06/2014, 01:20
  • 8
  • 381
  • 0
Báo cáo y học: " Impairment of chondrocyte biosynthetic activity by exposure to 3-tesla high-field magnetic resonance imaging is temporar" pptx

Báo cáo y học: " Impairment of chondrocyte biosynthetic activity by exposure to 3-tesla high-field magnetic resonance imaging is temporar" pptx

... flow of electrolytes and charges that ultimately impair cartilage activity This assumption is fostered by our observations of a marked decrease in anabolic activity, as shown by sGAG synthesis ... proteoglycan synthesis of human articular chondrocytes: the role of nonenzymatic glycation Arthritis Rheum 1999, 42:1003-1009 48 Schafer SJ, Luyten FP, Yanagishita M, Reddi AH: Prot...
Ngày tải lên : 09/08/2014, 08:22
  • 11
  • 419
  • 0
Báo cáo khoa học: " Ramipril mitigates radiation-induced impairment of neurogenesis in the rat dentate gyrus" potx

Báo cáo khoa học: " Ramipril mitigates radiation-induced impairment of neurogenesis in the rat dentate gyrus" potx

... acutely affecting the rate of neurogenesis within the SGZ and might therefore play a role in maintaining the basal rate of neurogenesis as well [40] The mitigating effects of ramipril following 10 GyWBI ... of Ang I to Ang II, or by antagonizing the binding of Ang II with either of its receptor subtypes [23] Using the ACEi, ramipril, we previously reported tha...
Ngày tải lên : 09/08/2014, 10:20
  • 8
  • 327
  • 0
báo cáo khoa học: " The extent of the psychological impairment of prosthodontic outpatients at a German University Hospital" doc

báo cáo khoa học: " The extent of the psychological impairment of prosthodontic outpatients at a German University Hospital" doc

... in approximately one third of the evaluated patients of both the POC and the TMD/ OFPOC the psychological impairment reached values that were located in the range of psychotherapeutic outpatients ... using the Mann-Whitney U test, the adequate statistical values are the mean ranks and the sum of ranks However, to improve the comparability of the obtained...
Ngày tải lên : 11/08/2014, 20:20
  • 8
  • 216
  • 0
Báo cáo y học: " Caseous calcification of the mitral annulus with mitral regurgitation and impairment of functional capacity: a case report" doc

Báo cáo y học: " Caseous calcification of the mitral annulus with mitral regurgitation and impairment of functional capacity: a case report" doc

... clinical and TTE followup yearly The noteworthiness of the case reported in this manuscript is that the patient had impairment of functional capacity (NYHA III functional class) and CCMA was responsible ... 2:205 because of co-existent mitral valve dysfunction In the latter situation it can be hypothesized that massive calcification may modify mitral annular dy...
Ngày tải lên : 11/08/2014, 21:22
  • 4
  • 344
  • 0
Báo cáo y học: "Impairment of alternative splice sites defining a novel gammaretroviral exon within gag modifies the oncogenic properties of Akv murine leukemia virus" pdf

Báo cáo y học: "Impairment of alternative splice sites defining a novel gammaretroviral exon within gag modifies the oncogenic properties of Akv murine leukemia virus" pdf

... CCTCTGATCTATATAACTGGAAAAATAATAATCCTTCCTTCTCTGAG GAT -AAAGAG GTAGGAA Akv- CD CCAGCGATCTATATAACTGGAAAAATAATAATCCATCATTCAGTGAA GAT -AAAGAG GTAGGAA Akv- EH CCTCTGATCTATATAACTGGAAAAATAATAATCCTTCCTTCTCTGAG ... 44 Akv- EH Akv- EH Akv wt Akv- EH Akv wt Akv- CD Akv- EH Akv- CD Akv wt Akv wt Akv- CD Akv wt Akv wt Akv wt Akv wt Akv wt Akv- CD Akv- CDH Akv- CDH Akv wt Akv...
Ngày tải lên : 13/08/2014, 05:22
  • 19
  • 178
  • 0
Báo cáo y học: "Memory-enhancing treatments reverse the impairment of inhibitory avoidance retention in sepsis-surviving rats" pdf

Báo cáo y học: "Memory-enhancing treatments reverse the impairment of inhibitory avoidance retention in sepsis-surviving rats" pdf

... after surgery the animals underwent an inhibitory avoidance test Inhibitory avoidance The inhibitory avoidance procedure was described in a previous report [15] The apparatus was an acrylic box ... limitations Explicitly or implicitly, learning tasks in animals involve the performance or the inhibition of some form of movement in response to sensory or other cu...
Ngày tải lên : 13/08/2014, 11:23
  • 6
  • 211
  • 0
Báo cáo y học: " In Vitro impairment of whole blood coagulation and platelet function by hypertonic saline hydroxyethyl starch" docx

Báo cáo y học: " In Vitro impairment of whole blood coagulation and platelet function by hypertonic saline hydroxyethyl starch" docx

... Surgery 1997, 122:609-616 doi:10.1186/1757-7241-19-12 Cite this article as: Hanke et al.: In Vitro impairment of whole blood coagulation and platelet function by hypertonic saline hydroxyethyl starch ... display fibrin polymerization only all tests Pentapharm, Munich, Germany) Since maximum clot firmness (MCF) in whole blood coagulation is mainly determined...
Ngày tải lên : 13/08/2014, 23:20
  • 8
  • 317
  • 0