OReilly learning scala practical functional programming for the JVM

... http://www.springeronline.com For information on translations, please e-mail info @apress. com, or visit http://www .apress. com Apress and friends of ED books may be purchased in bulk for academic, corporate, ... titles For more information, reference our Special Bulk Sales–eBook Licensing web page at http://www .apress. com/info/bulksales The information in this book is distributed on an...

Ngày tải lên: 06/08/2013, 17:29

... Functional Programming for Java Developers Functional Programming for Java Developers Dean Wampler Beijing • Cambridge • Farnham • Köln • Sebastopol • Tokyo Functional Programming for Java Developers ... to Functional Programming for Java Developers Why should a Java developer learn about functional programming (FP)? After all, hasn’t functional...

Ngày tải lên: 17/02/2014, 11:20

... observations of the effects of seasonal temperature acclimation on the properties of purified LDH-A from skeletal muscle of weatherfish Misgurnus fossilis acclimatized to either °C (‘cold’ enzyme) or ... Assemblage of the clones yield the full-length cDNA sequences of at least two distinct LDH-A isoforms, which differ substantially in the coding sequence and...

Ngày tải lên: 19/02/2014, 02:20

... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... as a direct electron acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on...

Ngày tải lên: 07/03/2014, 12:20

... Findings and Discussion on the difficulties in learning English to Vietnamese consecutive interpreting for the third- year English majors at Haiphong Private University and suggested solutions ... 21 English – Vietnamese consecutive interpreting for the third- year English majors at Haiphong Private University and suggeste...

Ngày tải lên: 19/03/2014, 17:07

... as the web server processes the user’s input and downloads new web pages for display Using Ajax Programming for the Absolute Beginner Ajax, you can change this application model so that only the ... run them directly within your browser For example, by visiting http://us .ajax1 3.com/en/ajaxwrite/ you can launch ajaxWrite As demonstrated in Figure 1.15, 16 Ajax Progr...

Ngày tải lên: 27/03/2014, 13:41

... information, please visit: www.kesdee.com of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of of 28 14 ... product are: Understand the Accounting Framework Understand the Accounting Process Understand the process of Finalization Understan...

Ngày tải lên: 29/03/2014, 14:20