The influence factors on green purchase behaviour based on consumption values theory and values attitude behaviour hierarchy
Environmental Health Sciences to develop and operate multidisciplinary research centers regarding the impact of envi- ronmental factors on women''''s health and disease prevention pptx
... NATIONAL INSTITUTE OF ENVIRONMENTAL HEALTH SCIENCES; AWARDS FOR DEVELOP- MENT PLINARY RESEARCH CENTERS REGARDING WOMEN’S HEALTH AND DISEASE PREVEN- TION AND OPERATION OF MULTIDISCI- Subpart 12 of ... 486) The Director of the Institute shall 19 carry out this section in consultation with the Director of 20 the Office of Research on Women’s Health...
Ngày tải lên: 22/03/2014, 11:20
Báo cáo khoa học: "The influence of the PRKAG3 mutation on glycogen, enzyme activities and fibre types in different skeletal muscles of exercise trained pigs" pot
... Granlund et al.: The influence of the PRKAG3 mutation on glycogen, enzyme activities and fibre types in different skeletal muscles of exercise trained pigs Acta Veterinaria Scandinavica 2011 53:20 ... femoris and m longissimus dorsi in the carriers than in the noncarriers Discussion The main new finding of this study is, that after exerci...
Ngày tải lên: 12/08/2014, 18:22
INVESTIGATION OF THE EFFECT OF THE DIFFERENT FACTORS ON THE STAR POLYACRYLATE PREPARATION BY ATRP METHOD
... addition of Cu(0) Keq = 9.37×10-7 Recommendations Investigate the effect of the others factors on ATRP such as initiator,temperature, reaction time,… The effect of factors on ATRP of n-butyl ... ethoxylate nonylphenol OH n Kinetics of ATRP The rate of monomer consumption in the propagation step is provided by : Equation (2) express the stea...
Ngày tải lên: 27/04/2015, 09:07
Báo cáo y học: " Efficacy of the Valsalva Maneuver on Needle Projection Pain and Hemodynamic Responses During Spinal Puncture"
... control groups.8 This study evaluated the efficacy of Valsalva maneuver on needle projection pain and hemodynamic responses during spinal puncture Methods and Materials This randomized clinical trial ... with the other groups (p
Ngày tải lên: 25/10/2012, 11:15
Lean Manufacturing and the Environment: Research on Advanced Manufacturing Systems and the Environment and Recommendations for Leveraging Better Environmental Performance doc
... recommendations presented in this report Lean Manufacturing and the Environment: Research on Advanced Manufacturing Systems and the Environment and Recommendations for Leveraging Better Environmental Performance ... Examination of the Relationship Between Lean Production and Environmental Performance. ” Forthcoming in Production and Operat...
Ngày tải lên: 15/03/2014, 19:20
Báo cáo Y học: Selection of effective antisense oligodeoxynucleotides with a green fluorescent protein-based assay Discovery of selective and potent inhibitors of glutathione S-transferase Mu expression doc
... TGAGAGCTGAAAGCAGGTCCAT G *A* GCTGCACGCTGCCG*T*C GGCGGATCGGGTGTGTCAGC CCACTGGCTTCTGTCATAGT GAAGTCCAGGCCCAGTTTGA TCAATTAAGTAGGGCAGATT TCTCCAAAACGTCCACACGA ACAAAGCATGATGAGCTGCA GAGTAGAGCTTCATCTTCTC ACTGGTCAAGAATGTCATAA ... ACTGGTCAAGAATGTCATAA CAGGTTTGGGAAGGCGTCCA CAGGCCCTCAAACCGAGCCA GTCTGGACTTTGTGGTGCTA GGCATGACTGGGGTGAGGTT AAAATCAGTGAGGGAAGGGT TCTAATCTCTCAGGCCAGGC GCAGCTCCCCCACCAGGAAC Unrelat...
Ngày tải lên: 31/03/2014, 15:20
báo cáo hóa học:" Proliferating and differentiating effects of three different growth factors on pluripotent mesenchymal cells and osteoblast like cells" pdf
... The effects of growth factors on the production of osteopontin and osteocalcin Biomed Sci Instrum 2006, 42:31-36 Gonnerman KN, Brown LS, Chu TM: Effects of growth factors on cell migration and ... coating on osteoblast like cells and pluripotent mesenchymal cells is also in accordance with previous studies [8,25,26] The proliferating effect of the...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo khoa học: " Self-assessed bowel toxicity after external beam radiotherapy for prostate cancer - predictive factors on irritative symptoms, incontinence and rectal bleeding" pptx
... external beam radiotherapy for prostate cancer with discrimination of the factors concerning rectal bleeding, bowel incontinence and irritative symptoms Patient-related and dose-volume-related factors ... of 14 questions for function and the subjective assessment of the associated bother ("no problem" - "very small problem" - "little problem" "moderate...
Ngày tải lên: 09/08/2014, 10:20
Báo cáo y học: "A critical review of the research literature on Six Sigma, Lean and StuderGroup''''s Hardwiring Excellence in the United States: the need to demonstrate and communicate the effectiveness of transformation strategies in healthcare" pdf
... represent innovative institutions with a history and expectation of research, thereby appearing to be natural settings for these types of investigations Evaluation of these and other transformative strategies ... clinic The inclusion of the comparison group, which had no changes, strengthens the conclusion the intervention was the necessary and sufficient conditio...
Ngày tải lên: 11/08/2014, 05:21
Báo cáo y học: " The influence of psychiatric screening in healthy populations selection: a new study and metaanalysis of functional 5-HTTLPR and rs25531 polymorphisms and anxiety-related personality traits" ppt
... article as: Minelli et al.: The influence of psychiatric screening in healthy populations selection: a new study and meta-analysis of functional 5-HTTLPR and rs25531 polymorphisms and anxiety-related ... genotyping of both the functional polymorphisms (5-HTTLPR and rs25531) and the haplotypes analysis should be taken into account in...
Ngày tải lên: 11/08/2014, 15:22
báo cáo khoa học: " A critical review of the research literature on Six Sigma, Lean and StuderGroup''''s Hardwiring Excellence in the United States: the need to demonstrate and communicate the effectiveness of transformation strategies in healthcare" pot
... cultural change and quality and financial gains In contrast to the number of transformational strategies originating in manufacturing, StuderGroup's Hardwiring Excellence approach was created by a ... these transformational strategies change both practices and organizational culture? Such research and com- Table 1: Relationship of change and practice No Chang...
Ngày tải lên: 11/08/2014, 16:20
The effect of the summer doldrums on earnings announcement returns and ERCs
... price and/ or volume reaction is affected by the timing of the earnings announcement, such as the day of the week of the announcement (Dellavigna and Pollet 2009) or the time of day of the announcement ... on the relative summer absence of noise traders and its effect on earnings announcement price reactions and earnings response coeffic...
Ngày tải lên: 30/09/2015, 14:28
radiation transmission based thickness measurement systems theory and applications to flat rolled strip products
... spectrum’s peak intensity to shift to higher energies www.intechopen.com Radiation Transmission- based Thickness Measurement Systems - Theory and Applications to Flat Rolled Strip Products 117 Fig 3.9 ... them to move at much faster speeds toward the central filament www.intechopen.com Radiation Transmission- based Thickness Measurement Systems - T...
Ngày tải lên: 27/07/2014, 23:42