... bư c ( RTL coding) hay bư c Khi thi t k cu i ñã qua ñư c vòng ki m tra logic ñư c ñưa ñi làm m u th ( tapeout) Chương : Mã Verilog 3.1: Gi i thi u nh ng khái ni m b n c a Verilog Verilog m t ... line comment in Verilog //* This is a multiple line comments in Verilog Notice that it begins with a certain symbol and ends with a certain symbol*// [T t nhiên b n hoàn toàn có th vi t co...
Ngày tải lên: 11/08/2014, 19:47
... in terms of HDLs Verilog HDL has become one of the popular HDLs for the writing of high-level descriptions Figure 14 -2 illustrates the process Figure 14 -2 Basic Computer-Aided Logic Synthesis Process ... The advent of computer-aided logic synthesis tools has automated the process of converting the high-level description to logic gates Instead of trying to perform logic sy...
Ngày tải lên: 24/12/2013, 11:17
Tài liệu Logic Synthesis With Verilog HDL part 2 doc
... because synthesis tools can infer unnecessary logic based on the variable definition 14.3 .2 Verilog Operators Almost all operators in Verilog are allowed for logic synthesis Table 14 -2 is a list ... appear If you rely on operator precedence, logic synthesis tools might produce an undesirable logic structure Table 14 -2 Verilog HDL Operators for Logic Synthesis O...
Ngày tải lên: 24/12/2013, 11:17
Tài liệu Logic Synthesis With Verilog HDL part 3 doc
... timing Logic synthesis The RTL description of the magnitude comparator is read by the logic synthesis tool The design constraints and technology library for abc_100 are provided to the logic synthesis ... [3: 0] A; input [3: 0] B; output A_gt_B, A_lt_B, A_eq_B; wire n60, n61, n62, n50, n 63, n51, n64, n52, n65, n40, n 53, n41, n54, n42, n55, n 43, n56, n44, n57, n45, n58, n46, n59...
Ngày tải lên: 24/12/2013, 11:17
Tài liệu Logic Synthesis With Verilog HDL part 4 doc
... Figure 14- 8 Figure 14- 8 Vertical Partitioning of 4- bit ALU Figure 14- 8 shows vertical partitioning of the 4- bit ALU For logic synthesis, it is important to create a hierarchy by partitioning a large ... 14. 6.2 Design Partitioning Design partitioning is another important factor for efficient logic synthesis The way the designer partitions the design can greatly affect the output...
Ngày tải lên: 24/12/2013, 11:17
Tài liệu Logic Synthesis With Verilog HDL part 5 pptx
... chip 14.8 Summary In this chapter, we discussed the following aspects of logic synthesis with Verilog HDL: • • Logic synthesis is the process of converting a high-level description of the design ... synthesized • • • • • • Logic synthesis tools accept high-level descriptions at the register transfer level (RTL) Thus, not all Verilog constructs are acceptable to a logic...
Ngày tải lên: 24/12/2013, 11:17
Tài liệu Báo cáo " synthesis, cloning and expression in escherichia coli of a gene coding for Mcoti-ii " ppt
... gtgactgcag gaaggggatc cggctgctaa caaagcccga 280 281 aaggaagctg agttggctgc tgccaccgct gagcaataac 320 321 tagcataccc 361 TTTTTGCTGA cttggggcct AAGGAGGAAC ctaaacgggt TATATCCGGA cttgaggggt TATCCCGCAA ... taagacttttttacggcggcgctatcgctaacgggcccgcgc attctgaaaaaatgccgccgcgatagcgattgcccgggcgcg I L K K C R R D S D C P G A acgtaaacggcgccgttgccgataacgccgattgagctcggc tgcatttgccgcggcaacggctattgcggctaactc...
Ngày tải lên: 12/02/2014, 10:20
Verilog Codin g for Successful Synthesis
... rights reserved 15 Verilog Coding for Successful Synthesis always @(posedge clk) edgeSensed
Ngày tải lên: 02/07/2014, 12:45
logic synthesis with verilog hdl
... is Synthesis? Synthesis Design Flow Verilog HDL Synthesis Interpretation of few Verilog constructs Verification of the Gate-Level Netlist Modeling Tips for Logic Synthesis Impact of Logic Synthesis ... Advanced VLSI Design Lab, IIT KGP Tools used in the lab Verilog HDL Verilog XL by Cadence Logic Simulation Simvision by Cadence Logic Synthesis Design Compiler by...
Ngày tải lên: 22/10/2014, 06:53
modeling the prosody of vietnamese language for speech synthesis
... this thesis is to model the characteristics of Vietnamese prosody for speech synthesis It focuses on the influences of the macro -prosody on the micro -prosody, in three types of sentence: assertive, ... characteristics of Vietnamese prosody to generate the prosody description” for speech synthesis In this thesis, we just focus on the differences of...
Ngày tải lên: 19/02/2014, 08:58
ADVANCED VIDEO CODING FOR NEXTGENERATION MULTIMEDIA SERVICES doc
... original work is properly cited 22 Advanced Video Coding for Next-Generation Multimedia Services transform to produce a robust video coder An error-resilient video coding scheme using the MD technique ... Advanced Video Coding for Next-Generation Multimedia Services efficiency and error-resiliency The default settings of the original JM9.4 reference encoder are...
Ngày tải lên: 06/03/2014, 22:20
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... as a direct electron acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo khoa học: The 3¢-UTR of the mRNA coding for the major protein kinase C substrate MARCKS contains a novel CU-rich element interacting with the mRNA stabilizing factors HuD and HuR ppt
... 5¢-CCC CGG GCC CGA ATT CCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT CTT TCT TTC TTT TTT TTT TTC TCG AGC CCC-3¢; antisense: 5¢-GGG GCT CGA GAA AAA AAA AAA GAA AGA AAG AAA GAA AGA AAG AAA GAA AGA AAG ... luciferase -MARCKS construct and for transient transfection with the cDNAs coding for human HuD and HuR The mouse embryonic carcinoma cell line PCC7-Mz1 is a subclone of...
Ngày tải lên: 08/03/2014, 08:20