... Management, Vol.15 No SP3, November, 2007 36.2 Does Communicating Online With Other English Speakers Hinder Or Improve Learners' Speaking Skills? In this collaborative project, the partner groups had synchronous ... Management, Vol.15 No SP3, November, 2007 36.4 Does Communicating Online With Other English Speakers Hinder Or Improve Learners' Speaking...
Ngày tải lên: 18/10/2013, 14:15
... too—not just music To set the iPod up for data transfer, proceed like this: Connect the iPod to your Mac with its USB cable or dock Use the white one that came with the iPod (If this is the first time ... ready to copy files onto it or off it, at extremely high speeds, and go on with your life When you're finished working with the MacBook, eject it from the iMac's screen as you woul...
Ngày tải lên: 21/01/2014, 04:20
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc
... GTATGCGATGTGGAATTTG GATGCCTTCCAATGAATTAC GAACCAATGAAATAAGGGCG GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG GCATCAGAAAGCATAGGC TGGGAATACGATAGAGTAG GTTTAAACGAGCTCGAATTC ... CCGTCGACCAAGCTTATGTTTCCTTATTTTTACAGACG CCCCCGGGGCCACTTTCTGGTG GTACAAGCTTGTAAATTTTCGATGG CATAGAATTCTTGGTAATC AAAGTCGACATGTTGTCACGTAGACAG CAAGCAGGTGAATTAGGC GGGGATCCGTCGACCTGCAGCGTACGAA...
Ngày tải lên: 18/02/2014, 14:20
Báo cáo Y học: Molecular interaction of neutral trehalase with other enzymes of trehalose metabolism in the fission yeast Schizosaccharomyces pombe pdf
... Two main lines of evidence lead us to propose that in the fission yeast S pombe neutral trehalase (Ntp1p) interacts in vitro with other proteins involved in trehalose metabolism First, the activation ... description of an association between the hydrolytic enzyme trehalase and proteins involved in synthesis of trehalose, thus revealing a novel relatio...
Ngày tải lên: 08/03/2014, 23:20
Automating the Construction of Internet Portals with Machine Learning doc
... paper, or by the degree to cora.tex; 17/02/2000; 10:24; p.4 Automating the Construction of Internet Portals with Machine Learning Figure A screen shot of the query results page of the Cora search ... a) be the value of cora.tex; 17/02/2000; 10:24; p.10 Automating the Construction of Internet Portals with Machine Learning 11 selecting action a...
Ngày tải lên: 15/03/2014, 21:20
Báo cáo khoa học: Peroxisome proliferator-activated receptor a plays a vital role in inducing a detoxification system against plant compounds with crosstalk with other xenobiotic nuclear receptors docx
... 5¢-ACCACTCTCTGGATGTGATTGGA-3¢ and 5¢- TCAAGAACATTTTATTTCCCACATTTT-3¢ for Ugt2b5; 5¢-ATTGCCCATATGGTGGCCAAAGGAG-3¢ and 5¢- GGCTGCCACACAAGCGAGTAGGAAT-3¢ for Ugt2b37; 5¢-GGGAAGGACATGAAGGAGAGAGC-3¢ and ... 5¢-AGAGATGATCCCATGAGAAACGG TGAA-3¢ for Cyp 3a4 4; 5¢-AGATCATCATTCCTTGGCA CTGG-3¢ and 5¢- ATTGCAGAAAGGAGGGAAGATGG -3¢ for Cyp 4a1 0; 5¢-CCAGTTGAGTGACGAGGAG ATGG-3¢ and 5¢-TCTGCATGCCCTCAAATGTTACC-...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: Hepatocyte nuclear factor-4a interacts with other hepatocyte nuclear factors in regulating transthyretin gene expression pot
... Role of HNFs in transthyretin gene expression Z Wang and P A Burke Fig Mutation of the HNF binding site mainly disrupts the corresponding HNF binding ability, and not that of other HNFs Nuclear extracts ... treatment with cytokines HepG2 cells were treated with or without cytokines for 18 h The interaction of HNF protein with the DNA binding site was determined by ChIP assay...
Ngày tải lên: 23/03/2014, 03:20
maximizing your sales with microsoft dynamics crm 2011 [electronic resource]
... blank Maximizing Your Sales with Microsoft Dynamics CRM 2011 Introduction What Is Microsoft Dynamics CRM? Microsoft Dynamics CRM is a customer relationship management tool At its very core, Microsoft ... reports .85 x Maximizing Your Sales with Microsoft Dynamics CRM 2011 Chapter Scheduling Activities within the CRM Web Client 87 Working with a...
Ngày tải lên: 29/05/2014, 17:22
maximizing your sales with microsoft dynamics crm 2011
... blank Maximizing Your Sales with Microsoft Dynamics CRM 2011 Introduction What Is Microsoft Dynamics CRM? Microsoft Dynamics CRM is a customer relationship management tool At its very core, Microsoft ... reports .85 x Maximizing Your Sales with Microsoft Dynamics CRM 2011 Chapter Scheduling Activities within the CRM Web Client 87 Working with a...
Ngày tải lên: 29/05/2014, 17:22
Báo cáo sinh học: " Does Japanese encephalitis virus share the same cellular receptor with other mosquito-borne flaviviruses on the C6/36 mosquito cells?" doc
... penetration receptor for JEV on mosquito cells Discussion 2.1 The same receptor molecule(s) for mosquito- borne flaviviruses (JEV, WNV and DV) might present on the surface of mosquito cells The classic ... the vector -virus interaction of mosquito- borne flaviviruses is very similar Based on the studies previously demonstrated that the similar molecules...
Ngày tải lên: 18/06/2014, 18:20
báo cáo hóa học:" Acromioclavicular joint dislocation: a comparative biomechanical study of the palmaris-longus tendon graft reconstruction with other augmentative methods in cadaveric models" docx
... the statistical analysis and drafted the manuscript CKY was involved in the conception, participated in the coordination of the study and data analysis DAS and SS were involved in the critical revision ... acromion was in total contact with the lateral end of the clavicle [See Additional file 1] The distal clavicular reference point was defined as the point...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Does Japanese encephalitis virus share the same cellular receptor with other mosquito-borne flaviviruses on the C6/36 mosquito cells?" pot
... penetration receptor for JEV on mosquito cells Discussion 2.1 The same receptor molecule(s) for mosquito- borne flaviviruses (JEV, WNV and DV) might present on the surface of mosquito cells The classic ... the vector -virus interaction of mosquito- borne flaviviruses is very similar Based on the studies previously demonstrated that the similar molecules...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Research Article Combined Rate and Power Allocation with Link Scheduling in Wireless Data Packet Relay Networks with Fading Channels" pptx
... programming algorithm for link scheduling and joint rate and power control in wireless data packet relay networks with fading channels This approach captures the real-time utility of the network and ... allocation of link scheduling to the incoming links or the outgoing link, depending on whether or not the buffer level exceeds EURASIP Journal on Wireless...
Ngày tải lên: 22/06/2014, 19:20
Báo cáo lâm nghiệp: " Growth of wild cherry (Prunus avium L.) in a mixture with other species in a demonstration forest" ppsx
... stand-forming capacity of wild cherry as well as its capacity to keep its position in a stand MATERIAL AND METHODS A large stand with wild cherry trees as a standforming species in the area of Demonstration ... lime and alder (in accordance with their share of BA) Basic data on the stand species composition and mean stem are given in Table Average stand he...
Ngày tải lên: 07/08/2014, 03:22