eWork and ebusiness in architecture engineering and construction
Tài liệu Báo cáo " Study on reuse of heavy metal rich sludge in ceramic pigment and construction material production " docx
... absorption were analyzed/tested in the laboratory of Construction material, Hanoi University of Construction The environmental safety of sludge re-usage was assessed based on heavy metals leaching ... ratio origin material (%) In further study, heavy metal leaching into rain water with lower pH value and longer soaking time should be investigated; the use of mi...
Tài liệu Báo cáo "Proper orthogonal decomposition and recent advanced topics in wind engineering" pptx
... with emphasis on recent advanced topics in the wind engineering: (1) Analyzing, identifying and reconstructing the random surface pressure fields around some typical rectangular cylinders, moreover, ... in structural dynamics and wind engineering, Wind & Structures, 3, (2000) 221 [16] Chen, X., Kareem, A., Proper orthogonal decomposition- based modeling, analysis, and...
Terminology and symbols in control engineering
... 00/03 device-related solution in a simple and clear manner Fundamentals ⋅ Terminology and Symbols in Control Engineering Terminology in Control Engineering To maintain a physical quantity, such ... schulung@samson.de Internet: http://www.samson.de Part ⋅ L101 EN Terminology and Symbols in Control Engineering Introduction Terminology in Control Engin...
Báo cáo khoa học: Poneratoxin, a neurotoxin from ant venom Structure and expression in insect cells and construction of a bio-insecticide pot
... end of a signal peptide: 5¢-CAGAAGCGGAA GAAAGCATGCAAAGGCAGA-3¢ (number 2), were used In the second PCR the plasmid pFastBacPx was used as a template with upstream and downstream primers containing, ... the N-terminal fragment of the poneratoxin gene Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGT...
biotreatment downstream processing and modelling advances in biochemical engineering
... reviewed here within an engineering context Advancesin Biochemical Engineering Biotechnology, Vol 56 Managing Editor: Th Scheper Springer-VerlagBerlin Heidelberg 1997 Pratima Bajpai and Pramod K Bajpai ... of lignin in the alkaline pulping liquor The lignin reactions involved in kraft pulping have been studied extensively [3~6] About 90% of the lignin is removed, the 10% or so rem...
Từ khóa: