... with toxic shock- like syndrome J Clin Microbiol 29, 1562–1567 Lee PK & Schlievert PM (1989) Quantification and toxicity of group A streptococcal pyrogenic exotoxins Superantigen outside-in signaling ... receptor binding sites in the superantigen toxic shock syndrome toxin J Exp Med 181, 2229–2235 Kum WW, Wood JA & Chow AW (1996) A mutation at glycine residue 31 of toxic...
Ngày tải lên: 22/03/2014, 15:21
... pathogenesis, most notably the Toxic Shock Syndrome Toxin-1 (TSST-1) [1] This protein, secreted by S aureus, has the ability to cause a remarkable expansion of T lymphocytes displaying specific β chain ... Corticosteroid therapy for patients with toxic shock syndrome JAMA 1984, 252:3399-3402 Todd J, Fishaut M, Kapral F, Welch T: Toxic -shock syndrome associated with phage-group-I...
Ngày tải lên: 11/08/2014, 10:22
Hội Chứng Nhiễm Độc Cấp Tính - Toxic Shock Syndrome
... xốp ngừa thai âm đạo lâu 12 đến 18 tiếng Các yếu tố rủi ro bị TSS gồm: Trước có bị hội chứng nhiễm độc cấp tính SA Dùng băng vệ sinh đút âm đạo lâu dài, loại thấm nhiều Sử dụng xốp ngừa thai, ... vị Bấm vào www.HealthLinkBC.ca gọi số 8-1 -1 để biết chi tiết dịch vụ sức khỏe không cấp thiết B.C Muốn tìm trợ giúp cho người điếc khiếm thính, gọi số 7-1 -1 B.C Có dịch vụ...
Ngày tải lên: 19/07/2015, 08:46
Báo cáo y học: "n alternative approach to combination vaccines: intradermal administration of isolated components for control of anthrax, botulism, plague and staphylococcal toxic shock" docx
... the wild-type toxin [13] Antibodies that prevent botulism are presumed to inhibit binding of the toxin to neurons and thereby impede entry of the toxin into the cell Staphylococcal enterotoxin B ... buffered formalin Histology and immunohistochemistry Formalin-fixed tissues for histology were trimmed, processed, and embedded in paraffin according to established protocols [...
Ngày tải lên: 11/08/2014, 10:23
Báo cáo y học: " Vaccine based on a ubiquitous cysteinyl protease and streptococcal pyrogenic exotoxin A protects against Streptococcus pyogenes sepsis and toxic shock" pptx
... GATATACATATGCAACAAGACCCCGATCCAAGCC 3' SpeA reverse primer, with SpeB overlap: 5' GAGATTTAACAACTGGTTGCTTGGTTGTTAGGTAGAC 3' SpeB forward primer, with SpeA overlap: 5' GTCTACCTAACAACCAAGCAACCAGTTGTTAAATCTC ... caused by S pyogenes The results presented indicated that a vaccine consisting of a fusion between the inactivated bacterial superantigen SpeA and the cysteinyl protease SpeB...
Ngày tải lên: 11/08/2014, 10:23
Báo cáo y học: "Inhaled nitric oxide in acute respiratory distress syndrome with and without septic shock requiring norepinephrine administration: a dose–response study" ppt
... Comparative changes in (a) mean pulmonary artery pressure (∆MPAP) and (b) pulmonary vascular resistance index (∆PVRI) induced by increasing inspiratory intratracheal concentrations of inhaled ... hemodynamic and respiratory paramaters were measured at the same ventilator settings as in phase Statistical analysis Cardiorespiratory parameters at control were compared between groups us...
Ngày tải lên: 12/08/2014, 18:20
Báo cáo khoa học: "Cutaneous vascular reactivity and flow motion response to vasopressin in advanced vasodilatory shock and severe postoperative multiple organ dysfunction syndrome" pot
... microcirculatory response to a combined infusion of AVP and norepinephrine when compared with infusion of norepinephrine alone, using laser Doppler flowmetry in patients with advanced vasodilatory shock ... with advanced vasodilatory shock and severe postoperative multiple organ dysfunction syndrome did not compromise cutaneous reactive hyperaemia and flowmot...
Ngày tải lên: 12/08/2014, 23:22
Báo cáo y học: "Systemic Capillary Leak Syndrome associated with hypovolemic shock and compartment syndrome. Use of transpulmonary thermodilution technique for volume management" ppt
... associated with hypovolemic shock and compartment syndrome Use of transpulmonary thermodilution technique for volume management Scandinavian Journal of Trauma, Resuscitation and Emergency Medicine ... Systemic capillary leak syndrome Internal medicine (Tokyo, Japan) 2002, 41(11):909-910 21 Droder RM, Kyle RA, Greipp PR: Control of systemic capillary...
Ngày tải lên: 13/08/2014, 23:20
Tiếp cận lâm sàng một bệnh nhân shock
... không hồi phục không điều trò kòp thời Bệnh cảnh LS Shock khác tùy theo ng/ nhân chế bù đắp thích ứng thể TIẾP CẬN THEO NGUYÊN NHÂN Shock tim: Thực sự: bệnh tim, van tim, loạn nhòp tim Tắc ... hệ thống) Cung lượng Tim TIẾP CẬN THEO CƠ CHẾ BỆNH SINH Thực tế lâm sàng → khó tìm nguyên nhân Trong hoàn cảnh cấp cứu, Trong 30 - 60 phút đầu tiếp xúc với bn shock, ...
Ngày tải lên: 22/10/2012, 15:31
Báo cáo y học: "The Systemic Inflammatory Response Syndrome (SIRS) in acutely hospitalised medical patients: a cohort study"
... inflammatory response (SIRS) on arrival, community-acquired infection, sepsis, Acute medicaland septicaccording to 437) Acute medical patients according to systemic inflammatory response (SIRS) ... the relevance of SIRS in predicting morbidity and mortality among patients in a medical emergency ward Materials and methods Patient population All acutely hospitalis...
Ngày tải lên: 25/10/2012, 09:56
Báo cáo y học: "Bench-to-bedside review: The MET syndrome – the challenges of researching and adopting medical emergency teams"
... start of an MET program and years later *p
Ngày tải lên: 25/10/2012, 10:35
Báo cáo y học: "ISOLATION OF CHLAMYDIA PNEUMONIAE FROM SERUM SAMPLES OF THE PATIENTS WITH ACUTE CORONARY SYNDROME"
... endothelium (20) In the present paper we report, that viable elementary bodies of C pneumoniae with typical electron microscopic structure can be isolated from the serum samples of the patients with ... patients with acute coronary syndrome Furthermore, using combination of bacteriological and PCR-based methods we show herein that patients with acute c...
Ngày tải lên: 26/10/2012, 08:57
Báo cáo y học: " Autonomic Dysfunction Presenting as Postural Orthostatic Tachycardia Syndrome in Patients with Multiple Sclerosis"
... experience with the management of patients with POTS Initial therapy consisted of an increase in salt and fluid intake as well as aerobic reconditioning with resistance training to increase lower ... patients (27) In two patients the episodes of syncope were associated with prolonged periods of asystole felt to be neurocardiogenic in origin Postural orthostatic ta...
Ngày tải lên: 26/10/2012, 09:39
Báo cáo y học: "Comparison between single antiplatelet therapy and combination of antiplatelet and anticoagulation therapy for secondary prevention in ischemic stroke patients with antiphospholipid syndrome"
... focused on the secondary prevention of stroke with APS, and compared single antiplatelet therapy and a combination of antiplatelet and anticoagulation therapy in ischemic stroke patients with APS The ... Int J Med Sci 2010, with APS We therefore compared single antiplatelet therapy and a combination of antiplatelet and anticoagulati...
Ngày tải lên: 26/10/2012, 09:48