Screening of early and late onset alzheimer’s disease genetic risk factors in a cohort of dementia patients from liguria, italy

Báo cáo y học: "ncreased serum HO-1 in hemophagocytic syndrome and adult-onset Still''''s disease: use in the differential diagnosis of hyperferritinemia" docx

Báo cáo y học: "ncreased serum HO-1 in hemophagocytic syndrome and adult-onset Still''''s disease: use in the differential diagnosis of hyperferritinemia" docx

... contributions YI designed and organized the study YK, MT, and MI, conducted the laboratory work YK, MT, AU, SO, AS, HK, KT, and YI were involved in the analysis and interpretation of data YK, MT, and YI ... activity during the clinical course in patients with HPS and ASD We next examined the relation between the serum HO-1 level and other laboratory paramet...

Ngày tải lên: 09/08/2014, 06:22

9 566 0
Báo cáo y học: "Prevalence of Overactive Bladder, its Under-Diagnosis, and Risk Factors in a Male Urologic Veterans Population"

Báo cáo y học: "Prevalence of Overactive Bladder, its Under-Diagnosis, and Risk Factors in a Male Urologic Veterans Population"

... urinary symptoms and incontinence: the Canadian Urinary Bladder Survey BJU Int 2008; 101:52 Milsom I, Abrams P, Cardozo L, Roberts RG, Throff J and Wein A How widespread are the symptoms of an ... demographic data Mean age was 68 years old (quartile range: 59-77) The major ethnicities were European American (44%), African American (37%) and Hispanic American (11%) Table Demographics...

Ngày tải lên: 25/10/2012, 11:35

4 522 0
báo cáo hóa học: " Maximal COX-2 and ppRb expression in neurons occurs during early Braak stages prior to the maximal activation of astrocytes and microglia in Alzheimer''''s disease" pdf

báo cáo hóa học: " Maximal COX-2 and ppRb expression in neurons occurs during early Braak stages prior to the maximal activation of astrocytes and microglia in Alzheimer''''s disease" pdf

... in the initial upregulation of these factors seems unlikely, we cannot exclude the involvement of glia in the regulation of COX-2 or cell cycle protein expression in neurons at later stages of ... emerging data on the early role of oligomeric and protofibrilic forms of Aβ in AD is very interesting [25,26] Whether COX-2 and cell cycle proteins are pa...

Ngày tải lên: 19/06/2014, 22:20

5 450 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... 5¢-GTTCACCACCAGAAGCT GGTGTTCTTCGCTGAAGACGTGGGTTCTAACAAG GGTGCT-3¢; Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢; Abstart, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢; Abstop, ... 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACCATCAG-3¢ The PCR solution was prepared in the buffer supplied with the enzyme, and contained Aba, Abb and Abc at 40 nm each, and the start and...

Ngày tải lên: 18/02/2014, 13:20

16 691 0
Memory performance in healthy elderly without Alzheimer’s disease: effects of time and apolipoprotein-E pptx

Memory performance in healthy elderly without Alzheimer’s disease: effects of time and apolipoprotein-E pptx

... Neurobiology of Aging 22 (2001) 683– 689 Table Relationship of Time of Follow-up and APOE-␧4 to Memory, Visuospatial and Language Performance in Healthy Elderly Over years* Variable Memory Factor Time Time*APOE-␧4Š ... differences in the slope of performance over time There was no statistically significant difference at a particular interval In this study me...

Ngày tải lên: 05/03/2014, 21:20

7 474 0
LifeOut of Focus Alzheimer’s Disease and Related Disorders ppt

LifeOut of Focus Alzheimer’s Disease and Related Disorders ppt

... 27 LIFE OUT OF FOCUS: ALZHEIMER’S DISEASE AND RELATED DISORDERS One of the tragic effects of Alzheimer’s is that children and grandchildren may become strangers to victims of the disease Humans ... right times 43 LIFE OUT OF FOCUS: ALZHEIMER’S DISEASE AND RELATED DISORDERS THE COST OF ALZHEIMER’S DISEASE As you can imagine, Alzheimer’s disease i...

Ngày tải lên: 05/03/2014, 23:20

105 461 0
Báo cáo khoa học: Selecting cells with different Alzheimer’s disease c-secretase activity using FACS Differential effect of presenilin exon 9 deletion on c- and e-cleavage doc

Báo cáo khoa học: Selecting cells with different Alzheimer’s disease c-secretase activity using FACS Differential effect of presenilin exon 9 deletion on c- and e-cleavage doc

... E.H & Allsop, D ( 199 9) Alzheimer’s disease: correlation of the suppression of beta-amyloid peptide secretion from cultured cells with inhibition of the chymotrypsin-like activity of the proteasome ... for 72 h with various concentrations of inhibitor in a final dimethylsulfoxide concentration of 0.5% After 24 h the medium was replaced with fresh medium containing inh...

Ngày tải lên: 08/03/2014, 08:20

12 471 0
Báo cáo khoa học: Levels of mTOR and its downstream targets 4E-BP1, eEF2, and eEF2 kinase in relationships with tau in Alzheimer’s disease brain doc

Báo cáo khoa học: Levels of mTOR and its downstream targets 4E-BP1, eEF2, and eEF2 kinase in relationships with tau in Alzheimer’s disease brain doc

... p-eIF4E [10] in AD brains In the current study (Table 1), levels of total and p-forms of mTOR, 4E-BP1, eEF2, and eEF2K were investigated in relationship with tau in homogenates of the medial ... correlation with tau nonphosphorylated at Tau1 sites Total and phosphorylated levels of eEF2K and eEF2 in AD and control brains Levels of p-eEF2K w...

Ngày tải lên: 16/03/2014, 22:20

10 376 0
Báo cáo khoa học: In vitro gamma-secretase cleavage of the Alzheimer’s amyloid precursor protein correlates to a subset of presenilin complexes and is inhibited by zinc potx

Báo cáo khoa học: In vitro gamma-secretase cleavage of the Alzheimer’s amyloid precursor protein correlates to a subset of presenilin complexes and is inhibited by zinc potx

... c-secretase cleavage of APP substrates is inhibited by zinc and that zinc increases the apparent molecular mass of C1013FLAG as determined by size exclusion chromatography Residues 6–28 within Ab ... exposures allowed the detection of a protein with a calculated molecular mass of 11.1 kDa migrating between a- and c-3FLAG standard proteins that may correspo...

Ngày tải lên: 16/03/2014, 23:20

14 421 0
Báo cáo sinh học: "The immunological potency and therapeutic potential of a prototype dual vaccine against influenza and Alzheimer’s disease" pdf

Báo cáo sinh học: "The immunological potency and therapeutic potential of a prototype dual vaccine against influenza and Alzheimer’s disease" pdf

... 169:117-125 Page 15 of 15 doi:10.1186/1479-5876-9-127 Cite this article as: Davtyan et al.: The immunological potency and therapeutic potential of a prototype dual vaccine against influenza and Alzheimer’s ... in analyses and interpretation of data He drafted the manuscript AG has been involved in analyses and interpretation of data and statistical anal...

Ngày tải lên: 18/06/2014, 22:20

15 431 0
báo cáo hóa học: " Novel Aβ peptide immunogens modulate plaque pathology and inflammation in a murine model of Alzheimer''''s disease" potx

báo cáo hóa học: " Novel Aβ peptide immunogens modulate plaque pathology and inflammation in a murine model of Alzheimer''''s disease" potx

... appearance of "mature" amyloid plaques [26,30] These plaques contain fibrillar amyloid peptide and as such can be detected by thioflavine, a reagent that stains proteins in beta sheet conformation ... with oligo A or fAβ Characteristic of fibrillar amyloid plaques in both human AD brain and in mouse models of amyloid accumulation is robust association of activated ast...

Ngày tải lên: 19/06/2014, 22:20

19 483 0
báo cáo hóa học: " ELISA measurement of specific non-antigenbound antibodies to Ab1-42 monomer and soluble oligomers in sera from Alzheimer’s disease, mild cognitively impaired, and noncognitively impaired subjects" pptx

báo cáo hóa học: " ELISA measurement of specific non-antigenbound antibodies to Ab1-42 monomer and soluble oligomers in sera from Alzheimer’s disease, mild cognitively impaired, and noncognitively impaired subjects" pptx

... measurement of specific nonantigen-bound antibodies to Ab1-42 monomer and soluble oligomers in sera from Alzheimer’s disease, mild cognitively impaired, and noncognitively impaired subjects Journal of ... camera ELISA measurement of serum antibodies to Ab1-42 monomer and soluble oligomers Antibody concentrations to the Ab1-42...

Ngày tải lên: 19/06/2014, 22:20

11 410 0
báo cáo hóa học: " CRP gene variation affects early development of Alzheimer’s disease-related plaques" pdf

báo cáo hóa học: " CRP gene variation affects early development of Alzheimer’s disease-related plaques" pdf

... variation affects early development of Alzheimer’s disease-related plaques Journal of Neuroinflammation 2011 8:96 Submit your next manuscript to BioMed Central and take full advantage of: • Convenient ... that CRP production is upregulated in affected areas of AD brains [20] Some single nucleotide polymorphisms (SNPs) of the CRP gene have been shown to associate wit...

Ngày tải lên: 19/06/2014, 22:20

9 290 0
w