ATOMIC 2s 3p TRANSITION FOR PRODUCTION AND INVESTIGATION OF a FERMIONIC

Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

Tài liệu Báo cáo khoa học: Production and characterization of a secreted, C-terminally processed tyrosinase from the filamentous fungus Trichoderma reesei ppt

... genomic T reesei DNA with the following primers: forward, GGG GAC AAG TTT GTA CAA AAA AGC AGG CTA TCA TGC TGT TGT CAG GTC CCT CTC G; and reverse, GGG GAC CAC TTT GTA CAA GAA AGC TGG GTC AGT GGT ... and will enable more detailed analysis of the exact reaction mechanisms The tyrosinase structure, wherein the active site was located at the bottom of a large vacant space...

Ngày tải lên: 19/02/2014, 06:20

14 651 0
Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx

Báo cáo khoa học: Production and characterization of a thermostable L-threonine dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus docx

... iron- and zinc-containing alcohol dehydrogenase from the hyperthermophilic archaeon Pyrococcus furiosus J Bacteriol 181, 1163–1170 12 Shimizu Y, Sakuraba H, Kawakami R, Goda S, Kawarabayasi Y ... Journal compilation ª 2006 FEBS R Machielsen and J van der Oost 14 Higashi N, Matsuura T, Nakagawa A & Ishikawa K (2005) Crystallization and preliminary X-ray analysis of hyp...

Ngày tải lên: 16/03/2014, 14:20

8 415 0
Báo cáo khoa học: Production and characterization of a noncytotoxic deletion variant of the Aspergillus fumigatus allergen Aspf1 displaying reduced IgE binding ppt

Báo cáo khoa học: Production and characterization of a noncytotoxic deletion variant of the Aspergillus fumigatus allergen Aspf1 displaying reduced IgE binding ppt

... a preparation of A fumigatus mRNA obtained as described [22] The primers used were: Nt -Aspf1 (5¢-GTCGTCTTGCGGTCACCT GGACATGCATCAACGAACAG-3¢) and Ct -Aspf1 (5¢-GT CGTCTTGGATCCTCTCGAGTCTCAATGAGAACACA ... developed with an anti-Aspf1polyclonal antiserum (Fig 2B) The amino acid compositions of 2537 ´-Ortega et al L Garcia Variants of the A fumigatus allergen Aspf1 F...

Ngày tải lên: 16/03/2014, 19:20

9 517 0
báo cáo hóa học:" Research Article Accurate Asymptotic Formulas for Eigenvalues and Eigenfunctions of a Boundary-Value Problem of Fourth Order" pdf

báo cáo hóa học:" Research Article Accurate Asymptotic Formulas for Eigenvalues and Eigenfunctions of a Boundary-Value Problem of Fourth Order" pdf

... regular boundary value problems,” European Journal of Pure and Applied Mathematics, vol 1, no 2, pp 51–60, 2008 K R Mamedov and H Menken, Asymptotic formulas for eigenvalues and eigenfunctions of ... Sturm-Liouville Operators and Applications, vol 22 of Operator Theory: Advances and Applications, Birkh¨ user, Basel, Switzerland, 1986 a M A Naimark, Linear Different...

Ngày tải lên: 21/06/2014, 11:20

21 283 0
TARGETING ACUTE PHOSPHATASE PTEN INHIBITION AND INVESTIGATION OF A NOVEL COMBINATION TREATMENT WITH SCHWANN CELL TRANSPLANTATION TO PROMOTE SPINAL CORD INJURY REPAIR IN RATS

TARGETING ACUTE PHOSPHATASE PTEN INHIBITION AND INVESTIGATION OF A NOVEL COMBINATION TREATMENT WITH SCHWANN CELL TRANSPLANTATION TO PROMOTE SPINAL CORD INJURY REPAIR IN RATS

... remembered and appreciated iii ABSTRACT Chandler L Walker TARGETING ACUTE PHOSPHATASE PTEN INHIBITION AND INVESTIGATION OF A NOVEL COMBINATION TREATMENT WITH SCHWANN CELL TRANSPLANTATION TO PROMOTE SPINAL ... downstream Akt and mTOR signaling promotes programmed cell death i.e apoptosis and autophagy PI3K = Phosphatidylinositol 3-Kinase; PTEN =...

Ngày tải lên: 24/08/2014, 09:14

181 235 0
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 1 pptx

Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 1 pptx

... organisms as feed for the developing larvae The aim of the present manual was therefore to review and summarise the latest developments concerning the production and use of the major live food organisms ... also the production and use of live food organisms as feed for the developing larvae The present manual describes the major product...

Ngày tải lên: 15/12/2013, 00:15

15 791 2
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 2 doc

Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 2 doc

... - - Urea 7.5 - 1 2- 1 5 - 1 0-1 5 Calcium superphosphate 25 15 50 - - - Clewat 32 - - - - - N:P 16 /20 fertilizer - - - 1 0-1 5 - - N:P:K 1 6 -2 0 -2 0 - - - - 1 2- 1 5 - N:P:K 1 4-1 4-1 4 - - - - - 30 2. 3.1 .2 ... 7. 92 Algal-1 4.11 32. 22 8.83 8.65 Walne 4.04 13.37 13 .22 22 .28 ES 4...

Ngày tải lên: 15/12/2013, 00:15

45 654 0
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 3 ppt

Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 3 ppt

... - 150 0. 53 53 - 80 150 - 200 0.47 70 - 93 200 - 250 0.40 80 - 100 250 - 30 0 0 .37 92 - 110 30 0 - 35 0 0 .33 100 - 117 35 0 - 400 0 .30 105 - 120 400 - 450 0.27 107 - 120 450 - 500 0. 23 105 - 117 > ... Upscaling of stock cultures to starter cultures 3. 5 .3. 3 Mass production on algae 3. 5 .3. 4 Mass productio...

Ngày tải lên: 15/12/2013, 00:15

30 554 1
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 4 pptx

Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 4 pptx

... A par Basra - - Dayala - - Mahmoodia - - Urmia Lake B A urm Schor-Gol - - Shurabil - - Athlit - - Eilat North P A par Eilat South - - Chang Dao - - Tamano - - Yamaguchi P A par - - India Madras ... specific and remain relatively constant, (i.e they have become genotypical as a result of long-term adaptations of the strain to...

Ngày tải lên: 15/12/2013, 00:15

29 732 0
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 5 docx

Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 5 docx

... weeks, the use of decapsulated cysts constitutes a saving of over one third in the amount of Artemia cysts used, compared to the use of live nauplii Table 4.2.4 The proximate composition (in % of ... valorization of an otherwise inferior product The cysts have the appearance and the practical advantages of a dry feed and, in contrast to Artemia nauplii (47...

Ngày tải lên: 15/12/2013, 00:15

29 791 0
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 6 docx

Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 6 docx

... 2 0-2 3 3. 0-4 .3 3-1 1 5-7 2 4-2 7 1 4-1 7 7-1 0 1 7-2 0 1 0-1 5 2 8-2 9 2-5 3 0-3 4 20 1 0-1 5 1 0-1 5 3 5-3 7 20 2 0-3 0 3 8-4 1 0.05 20 3 0-4 0 Start of weaning 2 0-1 5 1 5-1 0 4 5-5 5 1 5-2 5 1 0-0 0.08 4 0-5 0 4 5-5 5 4 5-5 5 For example, ... P monodon PL-15 and the osmotic resistance of PL-10 This has recently been confirmed...

Ngày tải lên: 15/12/2013, 00:15

26 567 0
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 7 pptx

Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 7 pptx

... and attractive for the predators Table 4.4.3 Artificial seawater formulations used for tank production of Artemia (ing.l-1) For the Dietrich and Kalle formulation, solutions A and B are prepared ... influence the feeding behavior of Artemia by affecting the filtration rate, ingestion rate and/ or assimilation: including the quality and quantity of the food...

Ngày tải lên: 15/12/2013, 00:15

33 580 0
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 8 pptx

Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 8 pptx

... copepods and is also very toxic for shrimp The degradation of rotenone, chlorine and CaO to non-toxic forms is fairly rapid (24 - 48 h) If on the other hand tea-seed cake or dipterex are used, ponds ... accumulates on the pond bottom, they should only be used for a limited period of time Recommended levels of organic manure are 0.5 to 1.25 ton.ha-1 at the start...

Ngày tải lên: 15/12/2013, 00:15

53 596 0
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 9 pptx

Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 9 pptx

... of the plankton net may be fixed to the pond gates The amount of zooplankton collected depends on the zooplankton concentration in the water flowing out of the reservoir and on the volume of the ... However, one should be aware that the greater the surface area of the net the more effective and rapid the filtration Hence, the upper limit of the...

Ngày tải lên: 15/12/2013, 00:15

30 543 0
Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 10 pptx

Tài liệu Manual on the Production and Use of Live Food for Aquaculture - Phần 10 pptx

... l.m-3.day-1 in the following weeks The inoculation of the ponds is carried out on the 15th day at a rate of 10 daphnids per litre One month after the inoculation, blooms of more than 100 g.m-3 can ... particles from the water The efficiency of the filter allows even the uptake of bacteria (approx 1µm) In a study on the food quality of freshwater phytop...

Ngày tải lên: 15/12/2013, 00:15

15 531 0
w