Photoinduced reactivity of titanium dioxide-O. Carp, C.L. Huisman, A. Reller
... the walls of crevices in the gneisses of the Swiss Alps 1.2 Photoinduced processes TiO2 is characterized by the presence of photoinduced phenomena These are depicted in Fig All these photoinduced ... presence of reduction sites (as a result of treatments of the photocatalyst) can lead to ‘‘false positives’’ 3.4 Photoinduced superhydrophilicity UV illumination of TiO2 may...
Ngày tải lên: 21/12/2016, 10:59
... nonintegrated defect with a truncation for meromorphic mappings from a submanifold of Cl to a compact complex manifold Theorem 4.3 Let M be an n-dimensional closed complex submanifold of Cl and ω ... Let M be an n-dimensional closed complex submanifold of Cl and ω be its K¨ahler form that is induced from the canonical K¨ahler form of Cl Let f be an...
Ngày tải lên: 16/10/2015, 14:07
... stand-forming capacity of wild cherry as well as its capacity to keep its position in a stand MATERIAL AND METHODS A large stand with wild cherry trees as a standforming species in the area of Demonstration ... lime and alder (in accordance with their share of BA) Basic data on the stand species composition and mean stem are given in Table Average stand he...
Ngày tải lên: 07/08/2014, 03:22
Báo cáo lâm nghiệp: "Stand structure, competition and growth of Scots pine (Pinus sylvestris L.) in a Mediterranean mountainous environment" pptx
... structures of Scots pine, and an analysis was made of the variables in uencing this relationship in a mountain area with a continental Mediterranean climate, i.e., in the Guadarrama range (Spain) The ... 826 A Garc a- Abril et al Table I Stand area, climatic, topographic and soil type data of the four Scots pine stands studied Stand Uneven-aged With oak understor...
Ngày tải lên: 07/08/2014, 16:21
Báo cáo lâm nghiệp: "Above- and belowground distribution of dry matter and carbon biomass of Atlantic beech (Fagus sylvatica L.) in a time sequence" doc
... sub-divided dry matter and carbon biomass, of Atlantic lowland beech, during a forest rotation, at the stand scale Such a database could be used to provide a more accurate determination of carbon biomass ... determine the carbon biomass in each component of each stand The first was: by stand, component and individual, the carbon biomass was obtained by...
Ngày tải lên: 08/08/2014, 01:22
Báo cáo khoa học: Mycobacterium tuberculosis possesses a functional enzyme for the synthesis of vitamin C, L-gulono-1,4-lactone dehydrogenase doc
... (Paris, France): 5forGulox (forward), 5¢-GGGGACAAGTTT GTACAAAAAAGCAGGCTTCGATGACGACGACAAG ATGAGCCCGATATGGAGTAATTGGCCT-3¢; and 3revGulox (reverse), 5¢-GGGGACCACTTTGTACAAGAAA GCTGGGTCTCAGGGACCGAGAACGCGCCGGGTGT ... as a direct electron acceptor The animal and plant l-gulonolactone oxidoreductases are also active towards the l-galactono-1,4-lactone substrate Only scarce data are available on...
Ngày tải lên: 07/03/2014, 12:20
Báo cáo sinh học: " Involvement of PKR and RNase L in translational control and induction of apoptosis after Hepatitis C polyprotein expression from a Vaccinia virus recombinant" doc
... Time-course analysis of cellular and viral protein synthesis in cells expressing HCV polyprotein Time-course analysis of cellular and viral protein synthesis in cells expressing HCV polyprotein A: ... ends, and a large open reading frame (ORF) encoding a 3010–3030 amino acid polyprotein that is co- and posttranslationally cleaved by cellular and viral proteases to...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" Involvement of PKR and RNase L in translational control and induction of apoptosis after Hepatitis C polyprotein expression from a Vaccinia virus recombinant" docx
... Time-course analysis of cellular and viral protein synthesis in cells expressing HCV polyprotein Time-course analysis of cellular and viral protein synthesis in cells expressing HCV polyprotein A: ... ends, and a large open reading frame (ORF) encoding a 3010–3030 amino acid polyprotein that is co- and posttranslationally cleaved by cellular and viral proteases to...
Ngày tải lên: 20/06/2014, 04:20
Thiết kế hệ thống băng vít ngang vận chuyển xi măng với năng suất Q=80T-h, chiều dài v-c L=24 m
... trình m men sau: M1 + 2 .M2 +M3 = - Pn l 10 M2 + 2 .M3 +M4 = - Pn l M3 + 2 .M4 +M5 = - Pn l M4 + 2 .M5 +M6 = - Pn l M5 + 2 .M6 +M7 = - Pn l M6 + 2 .M7 +M8 = - Pn l Giải phương pháp ta : M0 = M1 = 304,846 ... t m M0, M1 , M2 , M3 ,M4 ,M5 ,M6 ,M7 ,M8 Aùp dụng công thức, tài liệu [6]: Phương trình m men có công thức tồng quát sau: a.MI-1 + 2.(a+b) MI + b.MI+1= -6 (ΩI.ZI + ΩI+1.ZI+1...
Ngày tải lên: 01/05/2013, 10:40
Tài liệu r e f e r e n c e p r a c t i c e a d v a n c e d o f b o o k a n d f o r l e a r n e r s E n g l pdf
Ngày tải lên: 19/01/2014, 07:20
Tài liệu B NÔNG NGHI P VÀ C NG HÒA XÃ H I CH NGH A VI T NAM PHÁT TRI N NÔNG THÔN Ð c l p - T do - H doc
... ng C c B o v th c v t, Ch nh V n ph ng B , Th tr ng n v thu c B t ch c, c nh n c li n quan ch u tr ch nhi m thi h nh quy t nh n y./ KT B TR NG TH TR NG B i B B ng DANH M C THU C B O V TH C ... TNHH H a N ng Á Ch u Sieusauray sâu khoang/ b# p c i 100 EC C ng ty TNHH Sitto Vi t Nam C ng ty TNHH N ng nghi...
Ngày tải lên: 20/01/2014, 13:20
Tài liệu Recabling of Lester B. Pearson Int’l Airport far from plain docx
... Management System is used in Pearson Airport s main computer room to run videosurveillance systems cased in concrete Access was gained through a series of secure maintenance holes From Terminal 2, the ... 23inch FL2000 series equipment from ADC Telecommunica- The fiber distribution center for the airport is located in an underground tunnel few seconds of interruption of service...
Ngày tải lên: 24/01/2014, 10:20
Tài liệu Báo cáo " Effect of Sweet potato (Ipomoea batatas (L.) Lam) leaf extract on hypoglycaemia, blood insulin secretion, and key carbohydrate metabolic enzymes in expermentally obese and STZ-induced diabetic mice " pptx
... 2 -diabetic mice Table Effect of extract fractions on blood fasting glucose and plasma insulin secretion in obese- diabetic mice Glucose (mmol/l) Treatment with extract fraction Starting point Final ... ND fed mice Therefore, obesity and insulin resistance were the important causes of diabetes 3.3 Effect of the extract fractions on blood fasting glu...
Ngày tải lên: 12/02/2014, 17:20