Development of a model to calculate the economic implications of improving the indoor climate
APPLYING THE OPTICAL MODEL TO CALCULATE THE NEUTRON CROSS SECTION
... go to the detectors Since we can control the incident beam, the number of neutrons that are removed from the beam must be impacted on by the interference Then, there are oscillations in the total ... total cross- section data Because we have not involved this effect, the calculation data is only the average values of the Ref [10] data Total neutron cross- section f...
Ngày tải lên: 26/09/2016, 22:46
Báo cáo " Using multi‐criteria analysis as a tool to select the feasible measures for sustainable development of brackish water shrimp culture in Quang Tri Province " doc
... present the results of an application of MCA to find out the most feasible measures for sustainable development of the brackish water shrimp culture in Quang Tri Province. The application of MCA ... pond area in the province. As shown in Fig. 2, the total area of brackish water shrimp culture has increased approximately 4 times, from 251 ha in 2000 to 902.5 ...
Ngày tải lên: 22/03/2014, 12:20
The Weapons Mix Problem - A Math Model to Quantify the Effects of Internetting of Fires to the Future Force pptx
... east RAND TR17 0-3 11 80 100 12 The Weapons Mix Problem: A Math Model to Quantify the Effects of Internetting of Fires to the Future Force The IOF Allocator shows that many of the cells with targets ... 14 The Weapons Mix Problem: A Math Model to Quantify the Effects of Internetting of Fires to the Future Force...
Ngày tải lên: 23/03/2014, 02:20
báo cáo sinh học:" Narrowing the gap between eye care needs and service provision: a model to dynamically regulate the flow of personnel through a multiple entry and exit training programme" pdf
... through training and into and out of the The computable model of an eye care MEES showing the stocks and flows of personnel through training and into and out of the workforce Figure illustrates the ... repeated for the four stages of training (Fig 5) To complete the non-physician sector of eye care personnel deployment and trainin...
Ngày tải lên: 18/06/2014, 17:20
báo cáo hóa học:" How to calculate the annual costs of NGO-implemented programs to support orphans and vulnerable children: A six-step approach" potx
... How to calculate the annual costs of NGO-implemented programmes to support orphans and vulnerable children: a six-step approach Bruce A Larson1,2§, Nancy Wambua3 Department of International ... Milligan, Jane Machira, Susan Wangai, Margaret Muthui, Juliana Masila, Ezekiel Ndondou and the many SLA facilitators and mentors participating in the CBCO pr...
Ngày tải lên: 20/06/2014, 08:20
A work force model to support the adoption of best practice care in chronic diseases – a missing piece in clinical guideline implementation pot
... knowledge of clinical practice guideline by clinicians This requires that guidelines are written in a way that is clear to clinicians and translatable into actions and an effective dissemination strategy ... established as part of model implementation to inform the sets of assumptions incorporated into the modelling The performance of the model is to be a...
Ngày tải lên: 11/08/2014, 05:21
báo cáo khoa học: " A work force model to support the adoption of best practice care in chronic diseases – a missing piece in clinical guideline implementation" ppt
... knowledge of clinical practice guideline by clinicians This requires that guidelines are written in a way that is clear to clinicians and translatable into actions and an effective dissemination strategy ... established as part of model implementation to inform the sets of assumptions incorporated into the modelling The performance of the model is to be ass...
Ngày tải lên: 11/08/2014, 16:21
A study to indicate the importance of consumer based-brand equity on consumer perception of brand (a case study of fast food restaurants).pdf
... increase the competitive advantage of the fast food restaurant The basic attribute of a fast food restaurant are also important for a fast food restaurant to excel because the strength of a brand ... qualities, brand loyalty, brand awareness, brand association and other propriety assets According to him, Brand loyalty has to with the level of...
Ngày tải lên: 24/09/2012, 17:19
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, ... [15] Metabolic control analysis has helped us to characterize the role of the individual genes in an operon and, to some extent, explain why L lactis may...
Ngày tải lên: 19/02/2014, 17:20
Báo cáo khoa học: The hyperfluidization of mammalian cell membranes acts as a signal to initiate the heat shock protein response pptx
... activation of kinases such as Akt has been shown to increase HSF1 activity Enhanced Ras maturation by heat stress was associated with a heightened activation of extracellular signal- regulated kinase ... Morphological study of the mammalian stress response: characterization of changes in cytoplasmic organelles, cytoskeleton, and nucleoli, and appearance of intranuclear...
Ngày tải lên: 07/03/2014, 12:20
Greener Events A guide to reducing the environmental impacts of conferences and seminars potx
... crockery, glassware & cutlery where possible (to reduce waste) This is part of Greener Events , a guide on reducing the environmental impacts of conferences and seminars There are also companion guides ... suitable venue and to aid planning discussions with management and staff at the venue A copy should be passed to the venue manager by the event mana...
Ngày tải lên: 16/03/2014, 19:20
the community development handbook a tool to build community capacity
... viable plan, motivation and the support of the community Basically, it takes capacity to build capacity, and it takes a well-thought-out process to start both capacity building and effective community ... there remains an underlying assumption that it is familiar to us and that we have a part to play in it This handbook has been created by the Labor Market Learn...
Ngày tải lên: 27/05/2014, 07:47
hacking vim a cookbook to get the most out of the latest vim editor
... Development Editor Nanda Nag Indexer Bhushan Pangaonkar Proofreader Chris Smith Nikhil Bangera Layouts and Illustrations Technical Editor Shantanu Zagade Ajay S Cover Designer Editorial Manager Dipali ... platform The first release of Vim for the Unix platform was out a year later and right away, it started to become an alternative to the vi editor The combination o...
Ngày tải lên: 01/06/2014, 10:43