Inclusive Insurance in Bangladesh and experience of PKSF_Abdul Karim

... History of Insurance in Bangladesh • History of insurance industry of Bangladesh traces its ancestry to the British-India and Pakistan regimes; • Before independence 67 insurance companies ... were operating; • Insurance companies were nationalized after the independence in 1971; • The Insurance Act 1938 has been replaced by the Act of 2010; • The office of the C...

Ngày tải lên: 05/12/2016, 17:40

... In Groundwater Of Bangladesh Field experience and available data shows that both soil and under groundwater of a vast area of Bangladesh has been threatened with arsenic contamination affecting ... Preliminary Results of Groundwater investigation in Arsenic affected areas in Bangladesh A Report Prepared by RGAG Japan RGAG(1999) Arsenic contamination of...

Ngày tải lên: 05/09/2013, 08:40

... Efficiency and Fairness Characteristics • Takes 7.5 seconds to reach 90% of the link capacity, independent of BDP • Satisfies max-min fairness if all the flows have the same end-to-end link capacity ... (Additive Increase Multiplicative Decrease) • Fair: max-min fairness • Stable: globally asynchronously stable • But, inefficient and not scalable – In grid networks (with high band...

Ngày tải lên: 15/01/2014, 15:59

... restless times from which comes background noise? Yes, how is such an image to greet the murmuring and the crackling and the tinkling and the crying and the sighing and rumbling and the roaring of ... birds and tree There was the agitation, the vacillation, the vibration There was, also, the movement of the time that made the time of day, the...

Ngày tải lên: 17/01/2014, 01:20

Ngày tải lên: 15/02/2014, 04:20

... Good practices in planning and management of integrated commercial poultry production in South Asia by R Prabakaran Professor of Poultry Science Tamil Nadu Veterinary and Animal Science ... researchers and those involved in development in general Good Practices in Poultry Production in South Asia Chapter Poultry Industry in South...

Ngày tải lên: 21/02/2014, 01:20

... should induce activation of all protein kinases shown to contribute to the neokyotorphin effect Both PKA and CaMK II are known to be activated by Ca2+ influx, in the case of CaMK II activation is ... established as neokyotorphin- effect mediators in L929 cells, are PKA, CaMK II and MAPK Discussion Fig Effect of lM neokyotorphin and 50 lM 8-Br-cAMP in L92...

Ngày tải lên: 07/03/2014, 11:20

... used for RT-PCR were: for the I7 OR (5¢-CGTCAAGGAGAAAAAACCCCGGATCT AAAAAATGGAGCGAAGGAACCACAG-3¢) and (5¢-AG CTGCCTGCAGGTCGACTCTAGAGGATCCTAACCAA TTTTGCTGCC-3¢); for OR17-40 (5¢-CGTCAAGGAG AAAAAACCCCGGATCTAAAAAATGGAGCAGAAAC ... recombination introducing the c-myc-OR17-40 coding sequence, using primers (5¢-CGTCAAGGAGAAAAAAC CCCGGATCTAAAAAATGGAGCAGAAACTCATCTC TGAAGAGGATCTG-3¢) and (5¢-G...

Ngày tải lên: 07/03/2014, 16:20

... about the responsibilities of both internal and external auditor in detecting and preventing fraud 2.3.1 Responsibilities of internal auditor Internal auditor plays an important role in fraud detection ... fraud and the responsibilities of auditor in detecting and preventing of fraud Fraud can be considered as most concerning problem of th...

Ngày tải lên: 13/03/2014, 14:20

... Movements: Definitions, Data and Method 46 TURKEY, 1980-2000: FINANCIAL LIBERALIZATION, MACROECONOMIC (IN)-STABILITY, AND PATTERNS OF DISTRIBUTION I Introduction Integration of the developing national ... extend of disassociation of the productive sphere of the domestic economy from its indigenous processes of accumulation and distribution As internationaliza...

Ngày tải lên: 15/03/2014, 19:20

... pieces are informing One day in September is more developed due to time it was produced The two show a big difference in the development of documentaries but I think Nanook was a very influential ... now and what he was like then In comparison One day in September is a better informing piece than Nanook because it uses more factors to keep the audience in...

Ngày tải lên: 21/03/2014, 21:59

... of the diagnosis intervals and initiation of treatment intervals with respect to days One hundred and three patients (50.5%) had delays in diagnosis and 51 patients (25%) had delays in initiation ... Med, 1992; 117: 251-53 24 Yamasaki-Nakagawa M, Ozasa K, Yamada N et al: Gender difference in delays to diagnosis and health care seeking behaviour in a rural...

Ngày tải lên: 22/03/2014, 18:20

Ngày tải lên: 28/03/2014, 15:20

... (IGF1R): Insulin-like Growth Factor- 1 receptor; (IGFBP-3): Insulin-like Growth Factor Binding Protein-3; (IGFBP-4): Insulin-like Growth Factor Binding; Protein-4; (MAPK): Mitogen-activated protein kinase; ... role of secreting IGFBPs in melanoma However, data not support the clinical utility of measuring levels of IGFBP-3 and -4 in sera of melan...

Ngày tải lên: 18/06/2014, 15:20

... article as: Jiang et al.: Overexpression of serine racemase in retina and overproduction of D -serine in eyes of streptozotocin-induced diabetic retinopathy Journal of Neuroinflammation 2011 8:119 ... of excess retinal D -serine into the ocular humors Compared to those in adult retina, levels of D -serine were easily detected by reverse-phase HPLC in...

Ngày tải lên: 19/06/2014, 22:20