Substitution of square planar complexes
... conditions of excess incoming ligand • We’ll look briefly at rate laws (details in text), consider primarily octahedral complexes Substitution Mechanisms Substitution Mechanisms Pictures: Substitution ... octahedral d3, low spin d4 - d6, strong field d8 square planar – Intermediate: weak field d8 – Labile: d1, d2, high spin d4 - d6, d7, d9, d10 Substitution Mechanisms • Two ex...
Ngày tải lên: 01/12/2016, 21:50
... for some of the differences observed in substrate recognition and RNA cleavage between RNases Sa2 and Sa 2¢-GMP in the active site of RNase Sa2 To obtain a set of complexes of RNase Sa2 with the ... understand the mechanism of RNA cleavage and differences in the catalytic properties of the two RNases, we have solved the structures of RNase Sa2 with...
Ngày tải lên: 18/02/2014, 11:20
... substitution mutant snake DNases I The thermal stabilities of the wild-type and mutant enzymes of the snakes were examined by measuring the activities remaining after incubation for 40 at various ... mechanism of generating a thermally stable enzyme form from a thermally unstable one: frog, toad and newt DNases I all have a Ser205 insertion in a domai...
Ngày tải lên: 20/02/2014, 23:20
Báo cáo khoa học: Reactions of gold(III) complexes with serum albumin docx
... present paper, we have tried to detail the reactions of a series of emerging antitumour gold(III) complexes of appreciable redox stability with serum albumin, used as a general model for globular ... interactions of some well known anticancer ruthenium(III) complexes and of auranofin with plasma proteins [19–21] Very scarce information exists on the reaction of gold...
Ngày tải lên: 07/03/2014, 21:20
Báo cáo khoa học: Cholecystokinin rapidly stimulates CrkII function in vivo in rat pancreatic acini Formation of CrkII–protein complexes docx
... formation of CrkII protein complexes in rat pancreatic acini Thus, in the present work, we investigated whether in vivo activation of the CCKA receptor regulates CrkII function to form protein complexes ... Fig Phosphotyrosine dependence of the CCK-8 induction of CrkII electrophoretic mobility shift in pancreatic acini Rat pancreatic acini preinc...
Ngày tải lên: 07/03/2014, 21:20
SUBSTITUTION OF HAZARDOUS CHEMICALS IN PRODUCTS AND PROCESSES potx
... chemicals in a variety of products and processes, serving a range of functionalities including cleaning operations (metal parts, facades, textiles), coating / painting / inking operations (marine anti-foulings, ... SUBSTITUTION OF HAZARDOUS CHEMICALS IN PRODUCTS AND PROCESSES • FINAL REPORT The authorities take the initiative and launch various kinds of suppor...
Ngày tải lên: 23/03/2014, 08:21
Báo cáo khoa học: Calpain involvement in the remodeling of cytoskeletal anchorage complexes potx
... a-actinin and c-filamin, are able to bind calpain with increasing affinity in the presence of calcium [32,39,69] Specific binding sites have been identified in the C-terminal EF-hand part of a-actinin ... kDa, corresponding to the head of the molecule The cleavage separates the talin N-terminal from the C- terminal domains and unmasks the integrin-binding site In viv...
Ngày tải lên: 23/03/2014, 10:21
Báo cáo khoa học: Deoxyribonuclease I footprinting reveals different DNA binding modes of bifunctional platinum complexes potx
... characterize the DNA binding of a number of small molecules of biological significance [1,6–15], including antitumor cis-diamminedichloroplatinum(II) (cisplatin) (Fig 1B) and its clinically ineffective ... formation, identification, and quantitation Biochemistry 24, 707–713 32 Anin MF & Leng M (1990) Distortions induced in double-stranded oligonucleotides by the binding of cis-dia...
Ngày tải lên: 23/03/2014, 10:21
THE SUMS OF SQUARE TECHNIQUE
... again, we can get the result J Now, I will present another proof of mine based on this theorem y x z y Since a, b, c > 0, abc = 1, there exists x, y , z > such that a = , b = , c = x then our inequality ... = 1, then 1 + + ≥ a + a +1 b + b +1 c + c +1 a = Proof From the given condition a, b, c > 0, abc = , there exist x, y , z > such that b = c = yz x2 zx And y2 xy z2 th...
Ngày tải lên: 05/06/2014, 18:39
Báo cáo sinh học: " Polymerase activity of hybrid ribonucleoprotein complexes generated from reassortment between 2009 pandemic H1N1 and seasonal H3N2 influenza A viruses" ppt
... Polymerase activity of hybrid ribonucleoprotein complexes generated from reassortment between 2009 pandemic H1N1 and seasonal H3N2 influenza A viruses ArticleCategory : Research Article ArticleHistory ... characterization of new swine-origin H1N1 influenza viruses Nature 2009, 460:1021–1025 Kashiwagi T, Hara K, Nakazono Y, Hamada N, Watanabe H: Artif...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Temperature sensitive influenza A virus genome replication results from low thermal stability of polymerase-cRNA complexes" doc
... polymerase leads to the synthesis of run-off transcripts with the sequence: AGUAGAAACAAGGGUGUUUUUUCCCGGGAAUUCGGAUCCACACCCUGCUUUUG CUand AGCAAAAGCAGGGUGUGUGGAUCCGAAUUCCCGGGUAAAAAACACCCUUGUUUCUACU, ... that replication of influenza virus is regulated by stabilization of replicative intermediates J Virol 2004, 78:9568-9572 Nakagawa Y, Oda K, Nakada S: The PB1 subunit alone can cataly...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo toán học: "Bijective census and random generation of Eulerian planar maps with prescribed vertex degrees" pptx
... function E(u, v) of balanced Eulerian trees with respect to number of positive and negative signs and the generating function M (u, v) of Eulerian maps with respect to number of vertices and faces satisfy: ... belong to any suiting balanced Eulerian tree of M Cut e0 and e1 , delete the end of e0 and start of e1 and close with a root edge the start of...
Ngày tải lên: 07/08/2014, 06:20
Báo cáo toán học: "New infinite families of almost-planar crossing-critical graphs" ppsx
... communication and preprint of [2]) that typical constructions of infinite families of simple 3-connected k -crossing-critical graphs create bounded numbers (wrt k) of vertices of degrees other than ... in infinite families of k -crossing-critical graphs? We positively answer one half of his question in Theorem 3.1 and Proposition 2.1; • namely we construct, for all k > 2...
Ngày tải lên: 07/08/2014, 21:20
Báo cáo khoa học: " Effect of multi-planar CT image reformatting on surgeon diagnostic performance for localizing thoracolumbar disc extrusions in dogs" docx
... reviewed for 111 dogs with confirmed thoracolumbar disc extrusions in order to test the effects of MPR CT images on surgeon diagnostic performance Surgeon diagnostic performance was assessed using ... assessment of canine IVDD The purpose of this study was to test the effects of MPR CT on surgeon diagnostic performance in a group of dogs with co...
Ngày tải lên: 07/08/2014, 23:22