... Scorpaeniformes within the Euteleostei [15] The hatching enzyme was identified from ovarian fluids of the black rockfish, and the cDNAs and the genes for the hatching enzyme were cloned from the embryos Results ... secreted from hatching gland cells to digest the chorion In this study, we observed the embryo hatching of the ovoviviparous black rock...
Ngày tải lên: 23/03/2014, 07:20
... Formation of Aerobic Granular Sludge Two AUFB reactors were used for the formation of aerobic granular sludge Air was introduced from the bottom of the reactor, and aeration rate was gradually increased ... in a continuous-flow reactor Both surface loading and aeration rates affect the selection of well-settling sludge and the formation of...
Ngày tải lên: 05/09/2013, 10:15
Tài liệu Cách thành lập số nhiều ( Formation of the plural) pptx
... Ex : brother-in-law => brothers-in-law Passer-by => passers by
Ngày tải lên: 24/12/2013, 19:15
Tài liệu Báo cáo " Method of sedimentary basin reconstruction and compilation of lithofacies - paleogeographic maps " pdf
Ngày tải lên: 13/02/2014, 12:20
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... chaperone proteins is also required The available data indicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature bc1 intermediate Yeast cytochrome bc1 core structure ... the bc1 complex in these two deletion strains, thus leading to the hypothesis that the addition of ISP may play a pivotal role in the structural re...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx
... the anion protein interactions in A-state stabilization Competition among anions To better define the effect produced by monovalent anions on the sulfate-induced A-state of cytochrome c, we monitored ... environment of the sulfate-induced A-state of cytochrome c, as observed from changes induced in the 416 nm Cotton effect (sulfate concentration: 50 mM) The e...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Oxidation inhibits amyloid fibril formation of transthyretin ppt
... and the kinetics of fibril formation of these oxidized proteins reveal the amino acid interactions that are critical in the onset of amyloidogenesis The rates of amyloid fibril formation for WT ... confirm that Oxidation inhibits amyloid fibril formation of TTR the methionine residues of WT TTR and V30M TTR are highly reactive toward oxidative modification The...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf
... Komaru et al Novel aggregate formation of an alkaline phosphatase frame-shift mutant Hypophosphatasia is an inborn error of metabolism characterized by defective mineralization of hard tissues and ... 2005 FEBS 1709 Novel aggregate formation of an alkaline phosphatase frame-shift mutant A K Komaru et al C 3000 2500 Alkaline phosphatase activity Alk...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, ... [15] Metabolic control analysis has helped us to characterize the role of the individual genes in an operon and, to some extent, explain why L lactis may...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo Y học: The insert within the catalytic domain of tripeptidyl-peptidase II is important for the formation of the active complex potx
... for formation of the TPP II complex Ó FEBS 2002 Formation of the tripeptidyl-peptidase II complex (Eur J Biochem 269) 1443 This amino acid is located in the insert within the catalytic domain, ... types of homodimers The insert within the catalytic domain is of importance for complex formation No functional significance has previous...
Ngày tải lên: 21/02/2014, 15:20
Báo cáo khoa học: Protein aggregation and amyloid fibril formation prediction software from primary sequence: towards controlling the formation of bacterial inclusion bodies pot
... calculated and reported, such as the average a4v in each hot-spot, the area of the aggregation profile above the HST, the total area (the HST being the zero axis) and the area above the HST of each ... set of 23 well-known amyloidogenic proteins and (c) guidance towards applying this software as a useful tool for improving the solubility of recombinant pr...
Ngày tải lên: 06/03/2014, 00:20
Báo cáo khoa học: Lysophosphatidylcholine modulates fibril formation of amyloid beta peptide doc
... influences fibril formation of Ab(1-40) and Ab(1-42) LPC modulates Ab fibril formation Results Effects of LPC on Ab(1-42) fibril formation To investigate the effects of LPC on Ab(1-42) fibril formation, ... the fibril formation process reached a plateau within h (Fig 1F) Effects of LPC on Ab(1-40) fibril formation Next, we investigated the fibrillogenic pr...
Ngày tải lên: 06/03/2014, 01:20
Báo cáo khoa học: Formation of highly toxic soluble amyloid beta oligomers by the molecular chaperone prefoldin pptx
... 5982–5993 ª 2008 The Authors Journal compilation ª 2008 FEBS 5983 Formation of amyloid beta oligomers by prefoldin M Sakono et al the presence of PFD were also separated by native PAGE and then subjected ... supports formation of a complex between PFD and Ab oligomers Toxicity of Ab oligomers Soluble Ab oligomers are highly cytotoxic and are found in AD b...
Ngày tải lên: 07/03/2014, 04:20
Báo cáo khoa học: New application of firefly luciferase ) it can catalyze the enantioselective thioester formation of 2-arylpropanoic acid docx
... (200 7) 3877–3885 ª 2007 The Authors Journal compilation ª 2007 FEBS (R) (R) (R) (R) (R) (R) (R) (R) (R) (R) (S) 3879 New application of firefly luciferase D.-I Kato et al ibuprofen, ketoprofen, ... and ee of the recovered acid (ee(s )) according to the equation: E ¼ ln[(1 ) c)(1 ) ee(s )) ] ⁄ ln[(1 ) c)(1 + ee(s )) ] [27] Entry Conversion ( %) Recovered...
Ngày tải lên: 07/03/2014, 10:20