Diarrhea is a Major killer of Children with Severe Acute Malnutrition Admitted to Inpatient Setup in Lusaka, Zambia
... Diarrhea is a Major killer of Children with Severe Acute Malnutrition Admitted to Inpatient Set-up in Lusaka, Zambia Abel H Irena‡¹, Mwate Mwambazi², Veronica Mulenga² ¹Valid International, ... Diarrhea is a major cause of complication in children with severe acute malnutrition admitted to the inpatient unit Under the current stand...
Ngày tải lên: 14/11/2016, 19:49
... ambulatory treatment of severe acute malnutrition in a developing country [13] That trial, with 437 children in Bangladesh in 1990 and 1991, showed that inpatient care cost $156 per child, day care ... alternative of providing no treatment [15] Household and societal costs of illness and care were beyond the scope of this study Decision tree The structure of...
Ngày tải lên: 13/08/2014, 11:22
... phosphatase This reverses the inhibition of synthase phosphatase by phosphorylase a There is a long-standing debate as to whether inactivation of phosphorylase is a component of the mechanism by which ... dephosphorylation of phosphorylase a [16], that inactivation of GSK-3 in the absence of phosphorylase inactivation is a small compo...
Ngày tải lên: 31/03/2014, 01:20
Báo cáo y học: "Atherogenic lipid profile is a feature characteristic of patients with early rheumatoid arthritis: effect of early treatment – a prospective, controlled study" pps
... Survival in rheumatoid arthritis: a population-based analysis of trends over 40 years Arthritis Rheum 2003, 48:54-58 Isomaki HA, Mutru O, Koota K: Death rate and causes of death in patients with rheumatoid ... in a fluorescence spectrometer at an excitation wavelength of 465 nm and emission wavelength of 535 nm [29] Statistical analysis All data were analyzed with the...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "Sepsis is a major determinant of outcome in critically ill HIV/AIDS patients." pdf
... survival of critically ill HIV/AIDS patients In this study, we prospectively followed up HIV/AIDS critically ill patients to evaluate the key factors related to outcome, with emphasis on impact of ... sepsis is the main risk factor for hospital mortality in a cohort of HIV/AIDS critically ill patients Sepsis-related mortality was increased in both shortand l...
Ngày tải lên: 13/08/2014, 21:21
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGA...
Ngày tải lên: 19/02/2014, 05:20
báo cáo hóa học:" A MIF haplotype is associated with the outcome of patients with severe sepsis: a case control study" pdf
... were associated with survival of severe sepsis when analyzed separately as well as analyzed as a haplotype Especially in the sub group of patients ≤60 years old and in patients with non-abdominal ... 0.052 Data are presented as mean and range of values death due to severe sepsis compared to patients without allele CATT7 The concomitance of the -173 allele C a...
Ngày tải lên: 18/06/2014, 15:20
báo cáo hóa học: " A psychometric evaluation of the PedsQL™ Family Impact Module in parents of children with sickle cell disease" pptx
... determining discriminant validity of the PedsQL™ Family Impact Module in our population of children with sickle cell disease, we collected data on the disease status of the children with sickle cell ... and reliable measure for assessing the impact of SCD on parents and families We therefore analyzed the following properties of the PedsQL™...
Ngày tải lên: 18/06/2014, 18:20
báo cáo hóa học: " A decision support framework for the discrimination of children with controlled epilepsy based on EEG analysis" pdf
... this article as: Sakkalis et al., A decision support framework for the discrimination of children with controlled epilepsy based on EEG analysis Journal of NeuroEngineering and Rehabilitation 2010, ... bivariate measures that can be treated similarly to the ones in the univariate case Once the additional synchronization features are calculated they are fe...
Ngày tải lên: 19/06/2014, 08:20
Báo cáo y học: "Natural killer cell dysfunction is a distinguishing feature of systemic onset juvenile rheumatoid arthritis and macrophage activation syndrome" pot
... carried out sample collection, flow cytometry, data analysis and manuscript preparation SL carried out NK cytotoxicity assays and manuscript preparation EHG carried out statistical analysis and ... manuscript preparation TBG carried out patient referral, clinical data analysis and manuscript preparation MHP carried out patient referral, clinical data analysis and manuscript preparat...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "The spliceosomal autoantigen heterogeneous nuclear ribonucleoprotein A2 (hnRNP-A2) is a major T cell autoantigen in patients with systemic lupus erythematosus" potx
... hnRNP -A2 in patients with RA [27] We observed that approximately half of the RA patients harbor T cells against hnRNP -A2 In accordance with the perception of RA as an inflammatory, Th1 type systemic ... hnRNP -A2 may constitute an important T cell autoantigen in patients with SLE, indicating a potential role for it in the pathogenesis of this disorder M...
Ngày tải lên: 09/08/2014, 08:22
báo cáo khoa học: "Down-regulation of UHRF1, associated with re-expression of tumor suppressor genes, is a common feature of natural compounds exhibiting anti-cancer properties" pot
... mark, emphases the possibility that numerous other natural compounds can take the same pathways leading to apoptosis apoptosis in colorectal cancer by activation of p53 and p73 which are negative ... carcinoma cells Anticancer Drugs 2003, 14:193-202 103 Yagi Y, Fushida S, Harada S, Kinoshita J, Makino I, Oyama K, Tajima H, Fujita H, Takamura H, Ninomiya I, Fujimura T, Ohta T, Yashiro M,...
Ngày tải lên: 10/08/2014, 10:21
Báo cáo y học: " A modelled economic evaluation comparing atomoxetine with methylphenidate in the treatment of children with attention-deficit/hyperactivity disorder in Spain" pot
... the Spanish context The economic evaluation employed a cost-utility analysis to calculate the incremental cost per quality-adjusted lifeyear (QALY) gained by atomoxetine compared with the treatment ... associated with atomoxetine treatment and thereby a greater number of QALYs overall in the context of the economic evaluation Overall, the incrementa...
Ngày tải lên: 11/08/2014, 17:20
Báo cáo y học: " Echoviruses are a major cause of aseptic meningitis in infants and young children in Kuwait" ppsx
... Echoviruses are a major cause of aseptic meningitis in infants and young children in Kuwait Virology Journal 2010 7:236 Page of Submit your next manuscript to BioMed Central and take full advantage of: ... 33 in Ulaanbaatar and Tov province, Mongolia, intrafamilial spread, and risk factors for infection Epidemiol Infect 2005, 133:1131-1142 Dalwai A, Ahm...
Ngày tải lên: 12/08/2014, 01:21
Báo cáo y học: "Timing of adequate antibiotic therapy is a greater determinant of outcome than are TNF and IL-10 polymorphisms in patients with sepsis." potx
... from this analysis) The rate of impairment in inflammatory response was significantly greater in patients with inadequate empirical antibiotic therapy than in patients with adequate empirical antibiotic ... determine the concentrations of proinflammatory and anti-inflammatory cytokines, and may influence whether patients have a marked hyper-inflammatory o...
Ngày tải lên: 13/08/2014, 01:20