Birth in taxi
Birth in taxi
... the pregnancy ‘s breathing,etc…, When she has a pain, her breathing is fast and shallow Until she don’t feel pain, her breathing is shallow and depends on the uterin Next, clean the baby’s ... One day, when you are a driver (a taxit-driver,…) on the road, and you see or have a pregnancy in your/a car She has a abdominal pain, and the baby’s head appear, what will you do? ... must push...
Ngày tải lên: 12/11/2016, 19:32
Báo cáo y học: "RNA interference for CFTR attenuates lung fluid absorption at birth in rats" doc
... GATCCGTGGAGAGATGAAGAAATATTTCAAGAGAATATTTCTTCATCTCTCCATTTTTTGGAAA-3' pSi-C1, reverse 5'GCTTTTCCAAAAAATGGAGAGATGAAGAAATATTCTCTTGAAATATTTCTTCATCTCTCCACG-3'; pSi-C2, forward 5'ATCCGAAAGTATATGTACCAAGATTCAAGAGATCTTGGTACATATACTTTCTTTTTTGGAAA-3', ... resulted in an increased mortality These results indicate that CFTR is involved in the transition from lung fluid secretion to fluid absorp...
Ngày tải lên: 12/08/2014, 15:21
The status, the factors that influence gender imbalance at birth in bac giang province and some effective interventions
... pre-intervention, EI=62.6% Chapter DISCUSS 4.1 The status of GIB in Bac Giang province and affecting factors 4.1.1 The sex ratio at birth of Bac Giang province, from 1999-2011 SRB of Bac Giang ... consulting at home - The effectiveness of intervention: + The SRB in the province and the studied districts in 2013 were lower than in 2011 (down 2.3...
Ngày tải lên: 11/05/2016, 09:58
Tài liệu Air pollution exposure during pregnancy and reduced birth size: a prospective birth cohort study in Valencia, Spain docx
... doi:10.1186/1476-069X-9-6 Cite this article as: Ballester et al.: Air pollution exposure during pregnancy and reduced birth size: a prospective birth cohort study in Valencia, Spain Environmental Health 2010 9:6 Submit ... Valencia, Spain 5Andalusian School of Public Health (EASP), Campus de la Cartuja s/n, Granada, Spain 6Department of Public Health, R...
Ngày tải lên: 17/02/2014, 22:20
Tài liệu Supporting Children Learning English as a Second Language in the Early Years (birth to six years) docx
... in a language other than English 11 Supporting Children Learning English as a Second Language in the Early Years (birth to six years) Learning English as a second or an additional language Babies ... English as a Second Language in the Early Years (birth to six years) Language delay Research has shown that mos...
Ngày tải lên: 24/02/2014, 18:20
Trial and Error: J. Marion Sims and the Birth of Modern Gynecology in the American South docx
... fame were a result of his surgical discoveries, including the invention the Sims Speculum and the Sims Position, and the use of silver sutures to prevent internal infections These innovations eventually ... profession the bold and intrepid pioneer in the art of gynecology … that genius, skill, and perseverance which developed it into a science, in the per...
Ngày tải lên: 05/03/2014, 15:20
Air pollution exposure estimation using dispersion modelling and continuous monitoring data in a prospective birth cohort study in the Netherlands potx
... home address, using a combination of continuous monitoring data and GIS based dispersion modelling techniques, taking into account both the spatial and temporal variation in air pollution In addition, ... at the home address using advanced state-of-theart methods By using a combination of GIS based dispersion modelling and continuous monitoring d...
Ngày tải lên: 06/03/2014, 19:20
The Production of Child Health in Kenya: A Structural Model of Birth Weight potx
... indicator of the overall health of the child in the womb Thus, the determinants of weight at birth are the same factors that determine the overall health of a baby in utero Another measure of infant health ... The Production of Child Health in Kenya: A Structural Model of Birth Weight Germano Mwabu Abstract The paper investig...
Ngày tải lên: 14/03/2014, 09:20
báo cáo hóa học: " Social and dental status along the life course and oral health impacts in adolescents: a population-based birth cohort" ppt
... statistical analysis and interpretation of data, and drafted the manuscript MAP participated in the collection, analysis and interpretation of data, and revising critically the manuscript CLPA, AMBM, ... schooling and mother employment status and dental status that may cause suffering, such as untreated dental caries in both deciduous and permanent dentition, g...
Ngày tải lên: 18/06/2014, 19:20
báo cáo hóa học:" Birth outcomes in South African women receiving highly active antiretroviral therapy: a retrospective observational study" pdf
... 0.71 All women have a CD4 ≤250 cells/mm3; HAART - highly active antiretroviral treatment; early HAART - HAART initiation
Ngày tải lên: 20/06/2014, 08:20
Báo cáo hóa học: " Risk factors for low birth weight in Botucatu city, SP state, Brazil: a study conducted in the Public Health System from 2004 to 2008" pptx
... Risk factors for low birth weight in Botucatu city, SP state, Brazil: a study conducted in the Public Health System from 2004 to 2008 ArticleCategory : Research Article ArticleHistory : ... Cátia Regina Branco da Fonseca,Aff1 Corresponding Affiliation: Aff1 Email: catiafonseca@fmb.unesp.br Maria Wany Louzada Strufaldi,Aff2 Email: mwany@uol.com.br...
Ngày tải lên: 21/06/2014, 19:20
status of postnatal care among mothers giving birth at the two hospitals in hanoi and an effect evaluation of home-based postnatal care model
... mothers giving birth at the two hospitals in Hanoi and an effect evaluation of home-based postnatal care model" The research is aiming at the followings: Describing status of knowledge, practice and ... Promoting postnatal care knowledge among mothers could help them provide good practices of postnatal care While the need of po...
Ngày tải lên: 25/07/2014, 11:36