1.3 Who should pay for higher educationquestions
Health Care for the Elderly - How Much? Who Will Pay For It pot
... If so, the key question is not, “Shall we it? ” but rather, Who will pay? ” If expenditures continue to grow at the same rate as they have in the past, health care for the elderly in 2020 will require ... growth of health care spending on the elderly or find ways to pay for the additional care • SLOW THE GROWTH OF HEALTH CARE SPENDING Only three ro...
Ngày tải lên: 22/03/2014, 14:20
Who Should Buy Long-Term Bonds? - INTERNATIONAL CENTER FOR FINANCIAL ASSET MANAGEMENT AND ENGINEERING pptx
... short-term risk This "myopic demand'' for long-term bonds can be large when risk aversion is small, because long-term bonds have attractive Sharpe ratios Second, long-term investors may hold long-term ... conventional wisdom, long-term bonds are appropriate for long-term investors who value stability of income We develop a model of optimal consumption and portfolio choice...
Ngày tải lên: 15/03/2014, 07:20
Báo cáo khoa học: NovelN,N¢-diacyl-1,3-diaminopropyl-2-carbamoyl bivalent cationic lipids for gene delivery – synthesis,in vitro transfection activity, and physicochemical characterization docx
... (2004) Physicochemical optimisation of plasmid delivery by cationic lipids J Gene Med 6, S24 S35 15 Wasungu L & Hoekstra D (2006) Cationic lipids, lipoplexes and intracellular delivery of genes ... diameter around lm Use of DOPE and cholesterol to enhance the genedelivery properties of cationic lipids has been extensively documented [1621] For 1,3lb2 and 1,3lb3, tr...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: Novel b-1,3-, 1,6-oligoglucan elicitor from Alternaria alternata 102 for defense responses in tobacco docx
... isolated from A alternata 102 Our previous work has indicated that the filtrate obtained from autoclaved A alternata 102 culture was able to induce marked chitinase activity in tobacco 2422 A alternata1 02 ... responses induced by AaGlucan in the intact tobacco plant seems similar to those induced by laminarin, which was reported to reduce pathogen infection [11], it No...
Ngày tải lên: 23/03/2014, 11:20
Báo cáo Y học: ik3-1/Cables is a substrate for cyclin-dependent kinase 3 (cdk 3) pdf
... residue is also phosphorylated by both cdk3/cyclin A and cdk3/E in vivo (Fig 5) Analysis of ik3-1 amino-acid sequence indicates that ik3-1 has a putative ZRXL (Z and X are typically basic) motif that ... previously [11] To replace Ser274 in ik3-1 cDNA with Thr or Ala, mutagenic primers, 50 -TCTCCGGAGATGTCGAACACT CTCAGGTACTCCCAGACCA -30 or 50 -TCTCCGGAGAT GTCGAACACTCTCAGGTGCTCCCAGACCA -3...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo hóa học: " GaInNAs-based Hellish-vertical cavity semiconductor optical amplifier for 1.3 μm operation" potx
... JE: 1.3 m vertical -cavity amplifier IEEE Photonics Technol Lett 2000, 12:951 Bjorlin S, Abraham P, Pasquariello D, Piprek J, Chiu Yi-J, Bowers JE: High gain, high efficiency vertical -cavity semiconductor ... PL: photoluminescence; QWs: quantum wells; VCSEL: vertical cavity surface emitting laser; VCSOA: vertical cavity semiconductor optical amplifier Acknowledgements F.AI C...
Ngày tải lên: 21/06/2014, 06:20
Giáo án tiếng anh lớp 5 - UNIT 9 ACTIVITIES FOR NEXT SUNDAY Section B (1-3) Period 45 doc
... Play game: Let’s talk F -Guide Ss to exercises 2.F T -Play game - < /b> Do exercises 8, in work book -T remarks the lesson -Learn by heart new words and structures -Prepare next < /b> lesson ... football? B: No I’m going to play volleyball (Yes, I am./No, I’m not) b Vocabulary: to take along(mang theo), cook lunch, next < /b> Sunday < /b> II TEACHING AIDS: Teacher’s: A cassette, pupp...
Ngày tải lên: 23/07/2014, 14:22
Báo cáo khoa học: " Cap-independent protein translation is initially responsible for 4-(N-methylnitrosamino)-1-(3-pyridyl)-butanone (NNK)-induced apoptosis in normal human bronchial pithelial cells" pot
... capindependent protein translation was responsible for early apoptosis To understand the relative roles of cap-dependent and -independent protein translations in NNK-induced apoptosis in human bronchial ... transfection with bicistronic constructs To determine the status of cap-dependent and independent protein translation in NNK-induced apoptosis in human b...
Ngày tải lên: 07/08/2014, 18:20
Báo cáo khoa học: "Molecular analysis of hprt mutation in B6C3F1 mice exposed to ozone alone and combined treatment of 4-(N-methyl-N-nitrosamino)-1-(3-pyridyl)-1-butanone and/or dibutyl phthalate for 32 and 52 weeks" ppsx
... hypoxanthineguanine phosphoribosyltransferase (hprt) locus of lymphocytes isolated from spleens of mice following exposure to ozone, NNK, and DBP, and combined treatments of NNK and DBP on ozone for 32- ... Molecular analysis of hprt mutation 383 Table DNA sequence analysis of hprt mutant in splenic cells of B6C3F1 male mice in 52- wk study Typ...
Ngày tải lên: 07/08/2014, 18:20
Báo cáo khoa học: "SemiWhole brain radiotherapy with a conformational external beam radiation boost for lung cancer patients with 1-3 brain metastasis: a multi institutional study" pdf
... presented with extra cranial failure/local brain failure/distant brain failure and extra cranial failure/distant brain failure, respectively Extra cranial failure and local brain failure only was observed ... metastases patients treated with accelerated-fractionation vs accelerated-hyperfractionated radiotherapy: an analysis from Radiation Therapy Oncology Group Study 91-04 I...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo khoa học: "Postmastectomy irradiation in breast in breast cancer patients with T1-2 and 1-3 positive axillary lymph nodes: Is there a role for radiation therapy" ppsx
... Cite this article as: Cosar et al.: Postmastectomy irradiation in breast in breast cancer patients with T1-2 and 1-3 positive axillary lymph nodes: Is there a role for radiation therapy? Radiation ... DMe Alive DM Death DM Death DM Death DM Death DM Alive Out-come a Lateral, bMedial, cInvasive ductal carcinoma, dInvasive Paget’s disease, eDistance...
Ngày tải lên: 09/08/2014, 09:20
nvestigating the influences of tidal inundation and surface elevation on the establishment and early development of mangroves for application in understanding mangrove rehabilitation techniques 1 3
... Surface elevations in mangroves, and its inherent control on periods of inundation and drainage, are therefore critical determinants of forest health For example, hyper- and hypo-salinity resulting ... periods, and hence surface elevations The general relationship between inundation durations and physiological functioning of mangroves is that prolonged inun...
Ngày tải lên: 22/09/2015, 15:19