... disambiguation methods In Proceedings of the International Conference on Theoretical and Methodological Issues in Machine Translation, pages 101–112 Rada Mihalcea and Dan I Moldovan 1999 An automatic ... topic signatures from Japanese text In particular cases, where one only cares about translation ambiguity, this technique can work on any language pair Conclusion and Future Work We...
Ngày tải lên: 08/03/2014, 04:22
... Vertical semi-Kaplan siphon Radial Siphon Parallel 6.15 Inverse semi-Kaplan siphon Radial Siphon Parallel 6.16 Inclined semi-Kaplan siphon Axial Siphon Parallel 6.17 Kaplan S Axial Gate valve Parallel ... 6.18 Kaplan inclined right angle Axial Gate valve Conical 6.19 Semi-Kaplan in pit Axial Gate valve Parallel 6.20 165 Guide on How to Develop a Small Hydropower Plant ESHA 2...
Ngày tải lên: 08/03/2014, 13:20
Báo cáo khoa học: S-nitrosylated proteins of a medicinal CAM plant Kalanchoe pinnata – ribulose-1,5-bisphosphate carboxylase⁄oxygenase activity targeted for inhibition pot
... Kalanchoe, Arabidopsis and animals Hypothetical protein, *not relevant in animals J K Abat et al S-nitrosylated proteins of Kalanchoe pinnata, a CAM plant 2865 S-nitrosylated proteins of Kalanchoe ... both Arabidopsis, a C3 plant [9], and K pinnata, a CAM plant (this study) Carbonic anhydrase is present in animals, plants, eubacteria and viruses [25] S-gluta...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: "A Semi-Supervised Key Phrase Extraction Approach: Learning from Title Phrases through a Document Semantic Network" docx
... valuable information for learning Figure F1-measure with in [0,1] 4.3 Comparison with Other Approaches Our approach aims at inferring important key phrases from title phrases through a semantic ... phrases are regarded as labeled samples, while the other phrases as unlabeled ones That is, the information we have at the beginning about how to rank phrases is that the...
Ngày tải lên: 23/03/2014, 16:20
Báo cáo khoa học: Biochemical and structural analyses of a higher plant photosystem II supercomplex of a photosystem I-less mutant of barley pot
... monomeric antenna proteins (CP26, CP29 and LHCII monomers) (band 2), and tri4620 meric LHCII (band 3), monomeric (band 4) and dimeric (band 5) PSII cores Bands and contained supramolecular complexes of ... the biochemical analyses reported above A Electron cryomicroscopy and image analysis of the two-dimensional arrays B Fig Analysis of polypeptide composition of grana...
Ngày tải lên: 30/03/2014, 10:20
Topic: Factors to make a company famous and repected
... the article? A Customer sevice is the most factor to make a company famous B Factors to make a company famous and repected C The companies need to consider the charity and advertising 2 What ... of customer • Products must have a unique feature to attract customers as well as compete with other companies Employee A staff that has the qualities and cap...
Ngày tải lên: 20/04/2014, 12:54
A new pilot plant scale acetifier designed for vinegar production in sub saharan africa
... of this paper was to apply a freeze-dried thermotolerant strain for a sustainable development of vinegar production into a new pilot plant scale acetifier via a semicontinuous process In this respect, ... Guiro AT, Thonart P Survival and preservation of thermoresistant acetic acids bacteria (TAAB) isolated from tropical products of Sub- Saharan Africa and destined...
Ngày tải lên: 05/05/2014, 08:44
TOPIC 10 – RELATIVE CLAUSE A – THEORY docx
... was nervous 14 He didn't wait at the traffic lights … were red 15 A police officer … car was parked at the next corner stopped and arrested them III Relative clause is necessary or not? A calendar ... bank … was robbed yesterday A boy … sister is in my class was in the bank at that time The man … robbed the bank had two pistols He wore a mask … made him look like Mickey Mouse He c...
Ngày tải lên: 07/08/2014, 19:21
Báo cáo khoa học: "The micronucleus frequency in cytokinesis-blocked lymphocytes of cattle in the vicinity of a nuclear power plant" ppt
... dnuof saw ecnereffid tnacifingis oN slamina eht fo etats lacigoloib lareneg eht etaulave ot demrofrep saw sisylana lacilototameH aera lortnoc a morf dna stnalp rewop raelcun eht ot tnecajda smraf ... lortnoc a dna stnalp rewop raelcun gnawggnoeY ,nijlU ,gnosloW eht fo ytiniciv eht ni elttac morf seulav lacigolotameH aera lortnoc eht ni slamina dna tnalp rewop raelcun a raen detacol slam...
Ngày tải lên: 07/08/2014, 20:23
báo cáo khoa học: " Identification of flowering genes in strawberry, a perennial SD plant" potx
... SVP SPY GA3ox GA2ox TFL1 AP2 CAGACCAGCAGAGGCTTATCTT CGGCATTACGTTCACTGCTA CAGGTGAGGCGGATAGAGAA CGCTCCAGAAGAAGGATAAGG TCTGAAGCACGTAAGGTCTA AAAGCTGGAGAAGGAGGCAGTC TGCATGGGGTAGTGAAACAA ACCCACATCGTTTGTGGTCT ... AGCCCTTGATGTCATCAGCTG TCTCCACACCTTTGATTGCCA GGAGAGCCAGAACCAGGAG GATCCAGCAGCAACCAAGTCTC CGTGCTAAGGCAGATGAATGG TGCGGTGTCAAATTGCATCA CCTCACAATCATCCACCAATCC CACCATGCCCAGAGCTTCA TGCAGAAACAAACGAG...
Ngày tải lên: 12/08/2014, 03:21
Báo cáo y học: "The effect of refurbishing a UK steel plant on PM10 metal composition and ability to induce inflammation" ppsx
... content of the Utah valley PM10 in relation to its toxicity and pro-inflammatory potential, by carrying out a range of human [4], animal [5] and in vitro studies [6,7] Further analysis of Utah ... inflammation despite the probability that this sample contained the lowest PM10 mass The ability to cause pulmonary inflammation is generally considered to play an important...
Ngày tải lên: 12/08/2014, 18:21
studies of pathogenesis-related proteins in the strawberry plant partial purification of a chitinase-containing protein complex and analysis of an osmotin-like protein gene
... CHAPTER PARTIAL PURIFICATION OF A CHITINASE-CONTAINING PROTEIN COMPLEX IN THE STRAWBERRY PLANT 2.1 Introduction Plant chitinases are pathogenesis-related (PR) proteins, which are implicated in ... demonstrated in other PR protein families, there are acidic and basic isoforms of chitinases Basic chitinases are usually in the vacuole and have antifunga...
Ngày tải lên: 13/11/2014, 09:25
Bubble formation and bubble wall interaction at a submerged orifice
... by Ramakrishnan et al (1969), Satyanarayan et al (1969), Khurana and Kumar (1969), Ruff (1972), and Takahashi and Miyahara (1976,1979) The idealized two-stage bubble formation model by Ramakrishnan ... (McNallan and King (1982)) Fig 2.1 Bubble state diagram of McCann and Prince (1971) for a 4.7 mm orifice in an air-water system 2.3 Physical factors affecting bubble form...
Ngày tải lên: 12/09/2015, 09:21
Identification of plant as a novel and alternative host model for burkholderia pseudomallei
... Pseudomonas syringae and R solanacearum have been elucidated using Arabidopsis as a plant model (Quirino and Bent, 2003) 3.2 Materials and Methods 3.2.1 Plant Materials 3.2.1.1 Tomato and Arabidopsis ... and can be isolated from rice paddy fields in endemic areas such as Thailand Dharakul and Songsivilai first raised the question of a relationship between B pseudo...
Ngày tải lên: 09/10/2015, 10:49
Topic 2: Living in a multiracial community
... multi-racial (adj): a chủng tộc, nhiều chủng tộc decade (n): thời kỳ mười năm, thập kỷ absorb (v): hấp thu peculiarity (n): tính chất riêng, nét riêng biệt, nét đặc biệt in peace and harmony ... Trung Hoa Ấn Độ Vì nói sống cộng đồng a chủng tộc dạy cho ta nhiều học hữu ích mối quan hệ người New words: race (n): chủng tộc, giống người belief (n): tín ngưỡng composed (adj): gồm có, bao gồm...
Ngày tải lên: 21/10/2015, 08:07