Metabolism Fueling Cell Growth

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx

... GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAGCTGTCACTCAGCCGCAGCAG GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAGTCTGAGGTGATAACATTCCC GCGGGATCCCTGGACGGGCAGCCGATGAAG ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTGT ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCCTCAGCCCATTGGAAGGCACC ATAAGAATGCGGCCGCTCAAGGCAGCTCGCTCTCCTTTTT GCGGGATCCGTGAATAATCTGCACCCTCGA ATAAGA...

Ngày tải lên: 19/02/2014, 05:20

14 517 0
Tài liệu Báo cáo khoa học: Inhibition of pneumococcal choline-binding proteins and cell growth by esters of bicyclic amines pptx

Tài liệu Báo cáo khoa học: Inhibition of pneumococcal choline-binding proteins and cell growth by esters of bicyclic amines pptx

... shown) Inhibition of pneumococcal murein hydrolases by bicyclic amines As shown above, tropic esters of bicyclic amines were selected and characterized by biophysical methods as strong ligands ... that the bicyclic amines are also able to bind to the active site of Pce Effect of choline analogs on cell growth and viability Fig Effect of choline and an...

Ngày tải lên: 19/02/2014, 05:20

13 465 0
Báo cáo khoa học: MicroRNA-9 inhibits ovarian cancer cell growth through regulation of NF-jB1 ppt

Báo cáo khoa học: MicroRNA-9 inhibits ovarian cancer cell growth through regulation of NF-jB1 ppt

... 5541 MiR-9 inhibits ovarian cancer cell growth L.-M Guo et al Fig Dysregulation of NF-jB1 in ovarian cancer tissue samples The NF-jB1 expression level in the four pairs of human ovarian cancer tissue ... affects ovarian cell growth activity over the long term, because the inhibi5542 Fig Knockdown of NF-jB1 inhibits growth of ES-2 cells in vitro (A) Th...

Ngày tải lên: 07/03/2014, 00:20

10 413 0
báo cáo hóa học:" Curcumin induces chemo/radio-sensitization in ovarian cancer cells and curcumin nanoparticles inhibit ovarian cancer cell growth" pot

báo cáo hóa học:" Curcumin induces chemo/radio-sensitization in ovarian cancer cells and curcumin nanoparticles inhibit ovarian cancer cell growth" pot

... article as: Yallapu et al., Curcumin induces chemo/radio-sensitization in ovarian cancer cells and curcumin nanoparticles inhibit ovarian cancer cell growth Journal of Ovarian Research 2010, 3:11 ... of cisplatin treatment in cisplatin resistant cells by increasing the sensitivity of cells to apoptotic pathways and modulating nuclear β-catenin signaling...

Ngày tải lên: 20/06/2014, 07:20

12 334 0
Báo cáo sinh học: "Differences in the way a mammalian cell and yeast cells coordinate cell growth and cell-cycle progression" ppt

Báo cáo sinh học: "Differences in the way a mammalian cell and yeast cells coordinate cell growth and cell-cycle progression" ppt

... Schwann cells maintain a constant average size with repeated passaging We purified Schwann cells from postnatal day rat sciatic nerve by sequential immunopanning We maintained the cells in a proliferative ... big mammalian cells have been observed to grow faster than small cells of the same type and at the same point of the cell cycle It thus seems likely that mo...

Ngày tải lên: 06/08/2014, 18:20

10 424 0
Báo cáo y học: "The influence of serum, glucose and oxygen on intervertebral disc cell growth in vitro: implications for degenerative disc disease" potx

Báo cáo y học: "The influence of serum, glucose and oxygen on intervertebral disc cell growth in vitro: implications for degenerative disc disease" potx

... regulating IVD cell behaviour In this study, we have examined the relative influence of serum, glucose, and oxygen supply, singly or combined, on the growth pattern of bovine IVD cells Since the nutrient ... levels of oxygen and in medium supplemented with 20% FCS and 320 mg/dL glucose Cell proliferation and cell viability Monolayers were harvested by tr...

Ngày tải lên: 09/08/2014, 10:23

8 325 0
Báo cáo y học: "Functional characterization of Trip10 in cancer cell growth and survival" ppsx

Báo cáo y học: "Functional characterization of Trip10 in cancer cell growth and survival" ppsx

... University Results Immunostaining Trip10 is differentially methylated in human cancer cell lines and primary tumor specimens Cells were fixed in 2% formaldehyde in phosphate buffered saline (PBS) and ... Overexpression of Trip10 in IMR-32 cells caused Trip10 and huntingtin to colocalize and form perinuclear foci In contrast, while overexpression of Trip10 in...

Ngày tải lên: 10/08/2014, 05:21

10 438 1
Báo cáo y học: " Induction of apoptosis and inhibition of cell growth by tbx5 knockdown contribute to dysmorphogenesis in Zebrafish embryos" pptx

Báo cáo y học: " Induction of apoptosis and inhibition of cell growth by tbx5 knockdown contribute to dysmorphogenesis in Zebrafish embryos" pptx

... Lu et al.: Induction of apoptosis and inhibition of cell growth by tbx5 knockdown contribute to dysmorphogenesis in Zebrafish embryos Journal of Biomedical Science 2011 18:73 Submit your next ... proliferation in vitro [30] Our results revealed tbx5 insufficiency ultimately resulted in activation of apoptosis and inhibition of cell growth...

Ngày tải lên: 10/08/2014, 10:20

10 592 0
báo cáo khoa học: "Phenylhexyl isothiocyanate has dual function as histone deacetylase inhibitor and hypomethylating agent and can inhibit myeloma cell growth by targeting critical pathways" doc

báo cáo khoa học: "Phenylhexyl isothiocyanate has dual function as histone deacetylase inhibitor and hypomethylating agent and can inhibit myeloma cell growth by targeting critical pathways" doc

... suppresses growth and causes cell cycle arrest of RPMI8226 myeloma cells PHI suppresses growth and causes cell cycle arrest of RPMI8226 myeloma cells (A) PHI suppresses growth of RPMI8226 myeloma cells ... position was indicated PHI inhibits histone deacetylation We have previously shown that PHI can inhibit the histone deacetylase and induces histone hyperac...

Ngày tải lên: 10/08/2014, 22:20

10 295 0
báo cáo khoa học: "Effect of arginase II on L-arginine depletion and cell growth in murine cell lines of renal cell carcinoma" pptx

báo cáo khoa học: "Effect of arginase II on L-arginine depletion and cell growth in murine cell lines of renal cell carcinoma" pptx

... 0.017, L-arginine depletion by arginase II induces CD3ζ downregulation in Jurkat T-cells Jurkat T-cells rapidly lose CD3ζ in absence of L-arginine Therefore, we tested if L-arginine depletion by ... Conclusion Arginase II produced by renal cell carcinoma cells can modulate L-arginine levels to regulate both cell growth and T cell function Blocking argina...

Ngày tải lên: 10/08/2014, 22:20

10 389 0
báo cáo khoa học: "Transcriptional analysis of cell growth and morphogenesis in the unicellular green alga Micrasterias (Streptophyta), with emphasis on the role of expansin" pot

báo cáo khoa học: "Transcriptional analysis of cell growth and morphogenesis in the unicellular green alga Micrasterias (Streptophyta), with emphasis on the role of expansin" pot

... participated in the synchronization and RNA-extraction and in the interpretation of the data JG and LDV participated in the design of the experiments DI and WV conceived and supervised the study ... Vannerum et al.: Transcriptional analysis of cell growth and morphogenesis in the unicellular green alga Micrasterias (Streptophyta), w...

Ngày tải lên: 11/08/2014, 11:21

17 563 0
Từ khóa:
w