... experiences In the past two decades, the interest in emotions and in their impact on satisfaction (and lately on loyalty) has led to the recognition of their significant role in satisfaction formation (see ... 2.5 Emotions in a service context 2.5.1 Emotional content of service During the 1980’s, the concept of hedonic consumption arose, acknowl...
Ngày tải lên: 28/09/2015, 13:28
... IN-SERVICE TEACHER TRAINING ON TEACHER CHANGE NGHIÊN CỨU VỀ THAY ĐỔI CỦA GIÁO VIÊN DƯỚI TÁC ĐỘNG CỦA CHƯƠNG TRÌNH BỒI DƯỠNG CHUYÊN MÔN NGHIỆP VỤ HÈ M.A MINOR THESIS Field: English Language Teaching ... followed by the discussion of the limitations of the study as well as suggestions for further research PART C CONCLUSIONS Conclusions of the study After reviewing...
Ngày tải lên: 30/03/2015, 14:33
FLUKE - RJ45 Plug, The weakest link in High performance Cabling system
... The weakest link If you consider the entire structured cabling Channel, from the PC to the switch, the weakest link is the modular plug This is the point that has the potential for the lowest ... They all appear structured cabling system to the active makes the performance of the patch cord similar, and all have official-looking certifi- components They...
Ngày tải lên: 26/10/2013, 19:15
Tài liệu FLUKE - RJ45 Plug, The weakest link in High performance Cabling system pdf
... The weakest link If you consider the entire structured cabling Channel, from the PC to the switch, the weakest link is the modular plug This is the point that has the potential for the lowest ... They all appear structured cabling system to the active makes the performance of the patch cord similar, and all have official-looking certifi- components They...
Ngày tải lên: 16/01/2014, 21:20
Tài liệu Báo cáo khoa học: "Peeling Back the Layers: Detecting Event Role Fillers in Secondary Contexts" pdf
... 17th International Joint Conference on Artificial Intelligence J Finkel, T Grenager, and C Manning 2005 Incorporating Non-local Information into Information Extraction Systems by Gibbs Sampling In ... if it contains one or more answer key strings from any of the event roles This produced 3,092 positive training sentences All remaining sentences that not contain any answer key strings are...
Ngày tải lên: 20/02/2014, 04:20
TYING ODYSSEUS TO THE MAST: EVIDENCE FROM A COMMITMENT SAVINGS PRODUCT IN THE PHILIPPINES* pot
... estimate the impact on the probability of increasing savings, and the probability of increasing savings by at least 20 percent This enables a substantial increase in savings by a wealthy individual to ... VARIABLES AVAILABLE AT TIME OF RANDOMIZATION Client savings balance (hundreds) Active account Barangay’s distance to branch Bank’s penetration in barangay Standard d...
Ngày tải lên: 06/03/2014, 10:20
Measuring Changes in Service Costs to Meet the Requirements of the 2002 ppt
... estimates into the future to meet the reporting requirements In Table 1.1 we break down the process of estimating the savings into a series of steps The first step is to define the set of services ... how they are organized 18 Measuring Changes in Service Costs 533 584 civil engineering services contractor engineering and technical services They may not...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Cytochrome P460 of Nitrosomonas europaea Formation of the heme-lysine cross-link in a heterologous host and mutagenic conversion to a non-cross-linked cytochrome c ¢ pot
... oligonucleotides were 5¢- GTAACTGTAAGAGAACTGGTCAC- 3¢ (Lys70 to Arg), 5¢- GTAACTGTAGCAGAACTGGTCA G- 3¢ (Lys70 to Ala), and 5¢- GGTAACTGTATATGAA CTGGTCAG- 3¢ (Lys70 to Tyr) The resulting plasmids, pUCYPKR, ... spectrum Although catalytic activity was lost in the mutants, the ligand-binding capability and thus the pentacoordinate nature of the heme was con...
Ngày tải lên: 23/03/2014, 17:21
Báo cáo khoa học: Analyzing the catalytic role of Asp97 in the methionine aminopeptidase from Escherichia coli potx
... mutants of the MetAP-I from E coli S Mitra et al affect the DG value for the binding of the rst metal ion; however, the entropic factor (TDS) for the binding of the rst metal ion decreases in the ... Co(II)-binding site, and indeed bidentate binding of Glu97 may prevent binding of the solvent ligand that appears to be present in other mono-cobalt(II) specie...
Ngày tải lên: 30/03/2014, 02:20
Challenges in Defense Working Capital Fund Pricing Analysis of the Defense Finance and Accounting Service pdf
... Defense Working Capital Fund Pricing Policies: Insights from the Defense Finance and Accounting Service (Keating and Gates, 1999) That document analyzed the Defense Finance and Accounting Service s ... Cataloging -in- Publication Data Challenges in defense working capital fund pricing : analysis of the Defense Finance and Accountin...
Ngày tải lên: 30/03/2014, 14:20
Khóa luận tốt nghiệp tiếng anh:THE INFLUENCE OF SERVICE QUALITY ON CUSTOMER SATISFACTION IN THE FOOD BEVERAGE INDUSTRY IN VIETNAM: A CASE STUDY IN THE SYSTEM THE GIOI NGHIENG 2305 RESTAURANTS
... precise about the meaning and measurements of satisfaction and service quality Satisfaction and service quality have certain things in common, but satisfaction generally is a broader concept, whereas ... satisfaction in the food and beverage industry in Vietnam as a whole and in the Thegioinghieng 2305 restaurants • Step 5: Data Analysis • Step 6:...
Ngày tải lên: 05/07/2014, 10:08
Báo cáo y học: "Direct interaction of immunoglobulins with synovial fibroblasts: a missing link in the pathogenesis of rheumatoid arthritis" potx
... Given the variety of signaling pathways initiated by IGF-1 in fibroblasts, it may be speculated, as the authors mention briefly, that binding of antibodies to IGF-1R exerts a number of other, ... research on the interaction of RA-IgG and RASFs as well as other recent data, however, may change the picture It has been reported by Huizinga and colleagues that in a cohor...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Glycogen synthase kinase 3, circadian rhythms, and bipolar disorder: a molecular link in the therapeutic action of lithium" docx
... While there are many differences in the molecular and genetic details of the circadian machinery in mammals and Drosophila, the basic regulatory principles are maintained [20,21] Central to the molecular ... analysis and selection NA participated in the analysis of results and figure designs JW participated in the design of the study AM conceived of...
Ngày tải lên: 10/08/2014, 09:20
Báo cáo y học: "The efficacy of Link N as a mediator of repair in a rabbit model of intervertebral disc degeneration" ppt
... http://arthritis-research.com/content/13/4/R120 Figure Changes in DNA, proteoglycan (sulfated glycosaminoglycan) and hyaluronic acid content Changes in DNA, proteoglycan (sulfated glycosaminoglycan (GAG)) and hyaluronic acid ... aggrecan) as sulfated glycosaminoglycan using the 1,9-dimethylmethylene blue dye-binding assay [37], and for hyaluronate using a competitive hyaluronate-bindi...
Ngày tải lên: 12/08/2014, 17:22