this is a document for free using. anyway, Im just trying my best to fill the 20 characters limit _

Nano product preview march 2009  the applause   “ this is a fantastic effort”

Nano product preview march 2009 the applause “ this is a fantastic effort”

... Acetoacetic Ester Acetoacetic Ester O H3C O C C H C OCH2CH3 H Acetoacetic ester is another name for ethyl acetoacetate The "acetoacetic ester synthesis" uses acetoacetic ester as a reactant ... Alkylation of Ethyl Acetoacetate Alkylation of Ethyl Acetoacetate O H3C C O •• –C C OCH2CH3 H R Dr Wolf's CHM 201 & 202 X The anion of ethyl acetoacetate can be alkylated using an alkyl halide...

Ngày tải lên: 15/03/2014, 22:14

52 1,1K 0
Báo cáo khoa học: Ki-1⁄57 interacts with PRMT1 and is a substrate for arginine methylation pptx

Báo cáo khoa học: Ki-1⁄57 interacts with PRMT1 and is a substrate for arginine methylation pptx

... Functional association of Ki-1 ⁄ 57 and PRMT1 D O Passos et al Preparation of cytoplasmic and nuclear extracts, methylation assays with cellular Ki-1 ⁄ 57 and metabolic labeling Carlos H I Ramos and ... 57 interacts with RACK1 and is a substrate for the phosphorylation by phorbol 12-myristate 13-acetate activated protein kinase C J Biol Chem 279, 11444–11455 12 Oza...

Ngày tải lên: 16/03/2014, 13:20

16 368 0
Báo cáo Y học: ik3-1/Cables is a substrate for cyclin-dependent kinase 3 (cdk 3) pdf

Báo cáo Y học: ik3-1/Cables is a substrate for cyclin-dependent kinase 3 (cdk 3) pdf

... residue is also phosphorylated by both cdk3/cyclin A and cdk3/E in vivo (Fig 5) Analysis of ik3-1 amino-acid sequence indicates that ik3-1 has a putative ZRXL (Z and X are typically basic) motif that ... previously [11] To replace Ser274 in ik3-1 cDNA with Thr or Ala, mutagenic primers, 50 -TCTCCGGAGATGTCGAACACT CTCAGGTACTCCCAGACCA -30 or 50 -TCTCCGGAGAT GTCGAACACTCTCAGGTGCTCCCAGACCA -3...

Ngày tải lên: 24/03/2014, 04:21

7 308 0
Báo cáo khoa học: Helicobacter pylori neutrophil-activating protein activates neutrophils by its C-terminal region even without dodecamer formation, which is a prerequisite for DNA protection – novel approaches against Helicobacter pylori inflammation ppt

Báo cáo khoa học: Helicobacter pylori neutrophil-activating protein activates neutrophils by its C-terminal region even without dodecamer formation, which is a prerequisite for DNA protection – novel approaches against Helicobacter pylori inflammation ppt

... 5¢-GGTGCCTTTCACA TTCCACGCGAAGTTATGCACTTTCAT-3¢, 5¢-AATTTC TTCAGTGGCTTTCGCCACATTGAAAAAATCGGT-3¢, 5¢-GATCCTTTCAGCGAGATCCGCAAACATGTCCGC AAACTC-3¢ and 5¢-TTGCAGCATCCAAATGGACGCTT GCAACTTGGCCAATTG-3¢ for H2 5A, ... TTCCATATGAAAACATTTGAAATT-3¢) and HPNAP_ low (5¢-GCGGGATCCTTAAGCCAAATGGGCTTG-3¢), HPNAP_up (5¢-GCGGAATTCCATATGAAAACATTTG AAATT-3¢) and HPNAP_low (5¢-CCGCTCGAGAGCC AAATGGG-3¢), for pET...

Ngày tải lên: 30/03/2014, 04:20

16 352 0
build a website for free [electronic resource]

build a website for free [electronic resource]

... regarded as affecting the validity of any trademark or service mark Warning and Disclaimer Every effort has been made to make this book as complete and as accurate as possible, but no warranty ... the ISP provides email addresses for domains also Geek Speak domain name A domain name is just a fancy way of referring to the words that act as a website s address There are a number of...

Ngày tải lên: 30/05/2014, 23:31

353 730 0
This is a transcript of Warren Buffett''''s live interview on CNBC before appearing docx

This is a transcript of Warren Buffett''''s live interview on CNBC before appearing docx

... buy ads in the paper BECKY: Right, there are— are two proposals in congress that have gotten a lotta play One is from senate— is from Congressman Barney Frank who takes a look at— this idea that— ... choose among them, I'm gonna choose for one of two reasons, maybe both, price and laxity I mean, in a sense, the— having a monopoly or a duopoly arrangement, means that the rat...

Ngày tải lên: 28/06/2014, 17:20

7 325 0
Báo cáo y học: " Colour of sputum is a marker for bacterial colonisation in chronic obstructive pulmonary disease" pps

Báo cáo y học: " Colour of sputum is a marker for bacterial colonisation in chronic obstructive pulmonary disease" pps

... presence of bacterial colonisation and high bacterial load were a more severe degree of dyspnoea and a darker colour of sputum The degree of dyspnoea is a marker of severity of COPD and being a categorical ... participated in the analysis and interpretation of data AM and SV recruited the patients, collected data and participate in the design and analys...

Ngày tải lên: 12/08/2014, 11:21

9 395 0
A Study on Using English Songs in Teaching Listening Skill to Improve the Efficiency and Motivation for First-Year Non-English Major Students at Hai Duong Medical Technical University

A Study on Using English Songs in Teaching Listening Skill to Improve the Efficiency and Motivation for First-Year Non-English Major Students at Hai Duong Medical Technical University

... is an important factor that contributes to the success in teaching and learning foreign languages in general and in teaching and learning listening skills in particular 1.3 Songs as a motivator ... Therefore, the author chose English songs as the means to a research to improve the efficiency and motivation for first-year non -English m...

Ngày tải lên: 15/07/2015, 12:57

69 2,7K 9
A methodology for validation of integrated systems models with an application to coastal-zone management in south-west sulawesi

A methodology for validation of integrated systems models with an application to coastal-zone management in south-west sulawesi

... coastal-zone management, integrated river basin management and/or ecosystem-based river basin management (Nakamura, 2003) Embedded in these approaches are the concepts of participatory management and adaptive ... and evaluating management strategies, is that of policy analysis 22 Chapter1 Policy analysis and rapid assessment models According to Miser and Quade (1985),...

Ngày tải lên: 06/11/2012, 10:35

139 492 0
The RAND Corporation is a nonprofit research organization providing objective analysis and effective solutions that address the challenges facing the public and private sectors around the world. potx

The RAND Corporation is a nonprofit research organization providing objective analysis and effective solutions that address the challenges facing the public and private sectors around the world. potx

... This product is part of the RAND Corporation monograph series RAND monographs present major research findings that address the challenges facing the public and private sectors All RAND monographs ... Medicaid waiver by requiring that state laws and state Medicaid contracts mandate communication and information-sharing regarding maternal and child healt...

Ngày tải lên: 22/03/2014, 09:20

79 343 0
A handbook for project managers, developers, implementers, evaluators and donors working to counter trafficking in persons. ppt

A handbook for project managers, developers, implementers, evaluators and donors working to counter trafficking in persons. ppt

... coordinated information and awareness raising activities transnationally/between areas • X% increase in number of coordinated information and awareness raising activities transnationally/between areas ... provided in this handbook are meant to be, at a minimum, a starting point for anyone looking to develop performance indicators for counter- trafficking projects The...

Ngày tải lên: 30/03/2014, 01:20

80 377 0
A METHODOLOGY FOR VALIDATION OF INTEGRATED SYSTEMS MODELS WITH AN APPLICATION TO COASTAL-ZONE MANAGEMENT IN SOUTH-WEST SULAWESI " docx

A METHODOLOGY FOR VALIDATION OF INTEGRATED SYSTEMS MODELS WITH AN APPLICATION TO COASTAL-ZONE MANAGEMENT IN SOUTH-WEST SULAWESI " docx

... coastal-zone management, integrated river basin management and/or ecosystem-based river basin management (Nakamura, 2003) Embedded in these approaches are the concepts of participatory management and adaptive ... and evaluating management strategies, is that of policy analysis 22 Chapter1 Policy analysis and rapid assessment models According to Miser and Quade (1985),...

Ngày tải lên: 10/08/2014, 01:22

140 219 0
Best Practices for Organic Policy: What developing country Governments can do to promote the organic agriculture sector docx

Best Practices for Organic Policy: What developing country Governments can do to promote the organic agriculture sector docx

... to awareness raising for organic agriculture on all levels 16 What developing country Governments can to promote the organic agriculture sector Data The demand for data about the organic sector ... delivered to their homes 12 Recipient of the Right Livelihood Award 2004 What developing country Governments can to promote the organic...

Ngày tải lên: 28/03/2014, 19:20

105 303 0
w