Join with a conjunction 2
Join with a conjunction
... 12 Men have fought and died for their country 13 As he didn’t want to miss the train, he ran fast Be first to know when grammar rules change! Sign up to our newsletter here: englishgrammar.org
Ngày tải lên: 11/07/2015, 19:52
báo cáo hóa học:" Percutaneous endoscopic lumbar discectomy: clinical and quality of life outcomes with a minimum 2 year follow-up" doc
... Visual Analogue Scale pre and postoperatively Visual Analogue Scale pre and postoperatively tages of this technique include less paraspinal musculature trauma and smaller wounds Bone removal is ... preoperative and month and years postoperative NASS and VAS scores There was significant improvement in the NASS scores for back disability and neurogenic symptoms and the VAS sco...
Ngày tải lên: 20/06/2014, 01:20
Join with a relative pronoun
... belong to the Scheduled Castes and Tribes don’t have to pay the application fee Be first to know when grammar rules change! Sign up to our newsletter here: englishgrammar.org (It's free) Powered
Ngày tải lên: 11/07/2015, 19:52
Báo cáo y học: " Evaluation of Lumbar Facet Joint Nerve Blocks in Managing Chronic Low Back Pain: A Randomized, Double-Blind, Controlled Trial with a 2-Year Follow-U"
... Manchikanti L, Manchikanti KN, Manchukonda R, et al Evaluation of lumbar facet joint nerve blocks in the management of chronic low back pain: A preliminary report of a randomized, double-blind controlled ... 20: 539-45 Schwarzer AC, Wang SC, Bogduk N, et al Prevalence and clinical features of lumbar zygapophysial joint pain: A study in an Austra...
Ngày tải lên: 26/10/2012, 09:07
Tài liệu Báo cáo khoa học: Differentiation stage-dependent preferred uptake of basolateral (systemic) glutamine into Caco-2 cells results in its accumulation in proteins with a role in cell–cell interaction pptx
... Media Supplement as a substitute of FBS, and a defined amount of glutamine, as detailed below Measurement of L -glutamine uptake by Caco-2 cells Glutamine uptake in Caco-2 cells was initiated by adding ... FEBS Glutamine incorporation in Caco-2 proteins determining the relative uptake of glutamine; (b) by searching for changes in the intestinal proteo...
Ngày tải lên: 20/02/2014, 01:20
Báo cáo hóa học: " Vaccination with a plasmid DNA encoding HER-2/ neu together with low doses of GM-CSF and IL-2 in patients with metastatic breast carcinoma: a pilot clinical trial" pptx
... this article as: Norell et al.: Vaccination with a plasmid DNA encoding HER-2 /neu together with low doses of GM-CSF and IL-2 in patients with metastatic breast carcinoma: a pilot clinical trial ... tolerability of Her2-pDNA vaccination in combination with GM-CSF and IL-2 in a small number of advanced breast cancer patients...
Ngày tải lên: 18/06/2014, 16:20
Báo cáo hóa học: " The product of the Herpes simplex virus 1 UL7 gene interacts with a mitochondrial protein, adenine nucleotide translocator 2" pot
... AGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGACAGCAAGCGAACCGGAAT-3' GAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCGGAAATGTTGAATACTCA TACTCTTCCTTTTTC-3' The linear PCR-generated fragments were electroporated into YEbac102, an E coli DH10B ... for UL8; and 18 S rRNA-f (5'-actcaacacgggaaacctca-3') and 18 S rRNA-r (5'-aaccagacaaatcgctccac-3') for 18 S rRNA Reactions were performed using SYBER Premix Ex Taq II (...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Establishment of an animal model of a pasteurized bone graft, with a preliminary analysis of muscle coverage or FGF-2 administration to the graft" potx
... course of the establishment of a pasteurized bone model in rats, a preliminary analysis of the effect of the presence of muscle- covering to the pasteurized bone graft or the application of FGF-2 to ... [18], the size of the bone formation was also quantitatively measured in the lateral view using Alpha Ease FC software (Alpha Innot...
Ngày tải lên: 20/06/2014, 04:20
Chapter 052. Approach to the Patient with a Skin Disorder (Part 2) potx
... epidermal atrophy) Scar: A change in the skin secondary to trauma or inflammation Sites may be erythematous, hypopigmented, or hyperpigmented depending on their age or character Sites on hair-bearing ... that elicits the desire to scratch Pruritus is often the predominant symptom of inflammatory skin diseases (e.g., atopic dermatitis, allergic contact dermatitis); it is also c...
Ngày tải lên: 06/07/2014, 20:20
Báo cáo toán học: "Asymptotics of the average height of 2–watermelons with a wall" pps
... equation (23) in [6] 2.4 The average height of p–watermelons with a wall In generalization of the above notation, denote by m(n, p, h) the number of all p–watermelons of length n, which reach at ... 2, 1) + S(n, 2, 2) (14) 3.1 Asymptotic enumeration Asymptotics of the average height of 1–watermelons In the case of 1–watermelons, the asymptotic of the...
Ngày tải lên: 07/08/2014, 15:23