Ngày tải lên: 29/08/2016, 20:05
... (if/ whether ) Notes: S + asked ( O) Wanted to know + If/ whether + Wondered S+V Change in adverbs and articles this these here now tomorrow today → that → those → there → then → the following day ... adj: The adj +er + S+ V, The adj +er + S+ V Long adj: The more +adj + S+ V, The more +adj + S+ V 32 V + preposition be amazed at / be amused at/ be delighted at/ be interested in/ t...
Ngày tải lên: 17/08/2013, 23:10
Formation of Aerobic Granular Sludge in a Continuous-Flow Reactor – Control Strategy for the Selection of Well-Settling Granular Sludge
... Formation of Aerobic Granular Sludge Two AUFB reactors were used for the formation of aerobic granular sludge Air was introduced from the bottom of the reactor, and aeration rate was gradually increased ... in a continuous-flow reactor Both surface loading and aeration rates affect the selection of well-settling sludge and the formation of...
Ngày tải lên: 05/09/2013, 10:15
Exercises of conditional sentences
... it ' 28 I'd go and see him more often if he (live) on a bus route 29 If they (ban) the sale of alcohol at football matches there might be less violence 30 I (offer) to help if I thought I'd be ... serviced regularly 36 I'd climb over the wall if there (not be) so much broken glass on t of it III Conditional sentences: type Put the verbs in brackets into the correct tenses Prepared by P...
Ngày tải lên: 05/11/2013, 14:11
A study of english vietnamese translation of conditional sentences
... the task proposed in this thesis A study of English – Vietnamese Translation of Conditional sentences , we have provided an overview of different ways regarding to the translation of English conditional ... in translating English conditional sentences to practise the translation of English conditional sentences In fact, The samples of conditional...
Ngày tải lên: 26/11/2013, 13:27
Contrative analysis of primary sentences in english and those in vietnamese
... scope of using primary imperative sentences in English and that in Vietnamese; To suggest some practical applications about primary imperative sentences in English and those in Vietnamese Scope of ... Contrastive analysis of primary imperative sentences in English and those in Vietnamese Structure of the primary imperative sentences A...
Ngày tải lên: 12/12/2013, 00:03
Tài liệu Cách thành lập số nhiều ( Formation of the plural) pptx
... Ex : brother-in-law => brothers-in-law Passer-by => passers by
Ngày tải lên: 24/12/2013, 19:15
Tài liệu Báo cáo khoa học: Evidence that the assembly of the yeast cytochrome bc1 complex involves the formation of a large core structure in the inner mitochondrial membrane pdf
... chaperone proteins is also required The available data indicate that the accessory factor Bcs1p is involved in the binding of ISP to an immature bc1 intermediate Yeast cytochrome bc1 core structure ... the bc1 complex in these two deletion strains, thus leading to the hypothesis that the addition of ISP may play a pivotal role in the structural re...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Salt-induced formation of the A-state of ferricytochrome c – effect of the anion charge on protein structure docx
... the anion protein interactions in A-state stabilization Competition among anions To better define the effect produced by monovalent anions on the sulfate-induced A-state of cytochrome c, we monitored ... environment of the sulfate-induced A-state of cytochrome c, as observed from changes induced in the 416 nm Cotton effect (sulfate concentration: 50 mM) The e...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Oxidation inhibits amyloid fibril formation of transthyretin ppt
... and the kinetics of fibril formation of these oxidized proteins reveal the amino acid interactions that are critical in the onset of amyloidogenesis The rates of amyloid fibril formation for WT ... confirm that Oxidation inhibits amyloid fibril formation of TTR the methionine residues of WT TTR and V30M TTR are highly reactive toward oxidative modification The...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: Novel aggregate formation of a frame-shift mutant protein of tissue-nonspecific alkaline phosphatase is ascribed to three cysteine residues in the C-terminal extension pdf
... Komaru et al Novel aggregate formation of an alkaline phosphatase frame-shift mutant Hypophosphatasia is an inborn error of metabolism characterized by defective mineralization of hard tissues and ... 2005 FEBS 1709 Novel aggregate formation of an alkaline phosphatase frame-shift mutant A K Komaru et al C 3000 2500 Alkaline phosphatase activity Alk...
Ngày tải lên: 19/02/2014, 17:20
Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc
... GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢) (N ¼ A, T, G, C) and pykback (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for amplification of pyk The resulting PCR products, ... [15] Metabolic control analysis has helped us to characterize the role of the individual genes in an operon and, to some extent, explain why L lactis may...
Ngày tải lên: 19/02/2014, 17:20