Transformation of sentences

Ngày tải lên: 29/08/2016, 19:02

Ngày tải lên: 29/08/2016, 19:02

... data This indicates that our method of separating training data for all source particles is effective The transformation of passive sentences into active sentences is useful in many research ... separate training data for any source particles obtained an accuracy rate of 92.00% in Eval B The technique of separating training data into each source parti...

Ngày tải lên: 17/03/2014, 04:20

... cues from the training data (and also the test data) We also generated another set of training data by removing the majority countability features from them This set of training data was used ... included in training data For simplicity of implementation, they are excluded from training data (we will discuss the use of these excluded data in Section 6) Generat...

Ngày tải lên: 17/03/2014, 04:20

... expand The basic hypotheses of Marxist and postindustrial perspectives are summarized in Table 3.1 American class structure, 1960±1990 59 Table 3.1 Hypotheses for transformations of the American class ... working class is 54% of the labor force ± nevertheless, the trajectory of change is more in keeping with the expectations of post-industrial theory than tradi...

Ngày tải lên: 01/11/2013, 07:20

... passed on to small businesses in the form of lower prices Despite these positive aspects of the transformation of banking, one important concern remains about the impact on local economies—with the ... Source: Summary of Deposits, National Information Center Database II IMPACT OF THE CHANGES ON CONSUMERS Consumers have traditionally relied on nearby ba...

Ngày tải lên: 16/02/2014, 11:20

... 'movement of the soul', while by contrast in the experience of the beautiful we remain in restful contemplation Furthermore, the experience of the sublime involves the concept of infinitude Finally, the ... that of the movement of the soul and that of a feeling of infinitude, seems clearly on Wagner's mind where he associates the sublime with the 'hig...

Ngày tải lên: 19/02/2014, 17:20

... to the matching process The transformation is performed by means of a process of ~ inmtRntlat~nn OF the deflnition the translation of the de/initlon f~'om a set of criteria for satisfying the ... instances of the type CONTROL (CI, C2), and ~wo instances of PROPERTY (06, 09) were used The value of MAKEFULLLIST shows the survivors of STAGEI The value of...

Ngày tải lên: 21/02/2014, 20:20

... decomposition of TiN, as a result, it limits the growth of a-SiONWs nanowires by the mechanism Oxygen seems Fig A schematic diagram showing a growth mechanism of silica nanowires by the solid solid transformation ... diffusion of silicon from the silica films The growth mechanism could be explained by direct solid to solid phase transformation, so called,...

Ngày tải lên: 16/03/2014, 15:04

... [ingest,pat:[food,type:pasta]], [food,type:pasta], [food], and [pasta] Since all of these have 100% coverage in this example set, any of them could be chosen as the meaning representation for p a s t a Again, for clarity, ... percentage of this overlap At each iteration, the first step is to find and add to the output this best (w,t) pair Note that t can also be part of the repres...

Ngày tải lên: 17/03/2014, 09:20

... nanorods are a- FeOOH The gradual phase transformation from Fe3O4 to a- FeOOH with increasing volume ratios of alcohol/water is consistent with XRD results well The magnetism of the samples prepared in ... with 52% of Fe3O4 in mass and 48% of a- FeOOH in mass Results and discussion Figure shows XRD patterns of the samples prepared in pure wat...

Ngày tải lên: 19/03/2014, 16:48

... Transform vector pPTN289 -4CL1 into Chinaberrytree (Melia azedarach L.) and tested the existence of 4CL1 gene using PCR method Leaf disc transformation of Chinaberrytree (Melia azedarach L.) was ... plasmid and tested the Figure Testing the existence of 4CL1 using PCR method (line and 2) and NcoI/XbaI double digestion (line and 4) 3.3 Transformati...

Ngày tải lên: 22/03/2014, 09:20

... Primer location Amplified band (bp) P553 P554 P557 P558 GTGATTCTCTGCTAGATGTTG GGCACTCGAACAGTCATATTG ATTAAGGAGCTTCGGGAGATG CTCTTATACCCAATGCTGCTG First pair GCCTTTGAGTCCATCACTAAC CCAGTGTCTTGGCAGGAATC ... was and lg for placenta (lanes and 2, respectively) and 20 lg for the skin samples Side-chain cleavage of 7-DHC by placental and adrenal mitochondria Incubations were carried o...

Ngày tải lên: 23/03/2014, 13:20

... System for Automating Concordance Line Selection In Proceedings of NeMLaP, pages 95-100 H P Ednmndson 1969 New Methods in Automatic Extracting Journal of the ACM, 16(2):264-285 T Givon 1979 From ... 1958 The Automatic Creation of Literature Abstracts IBM Journal for Research and Development, 2(2):159-165 ~ ~ { ~ K Ono, K Sumita, and S Miike 1994 Abstract Generation based on Rhetoric...

Ngày tải lên: 23/03/2014, 19:20