13510 the santa claus song activity for a youtube video
Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc
... sulfur sulfur interactions in defining the catalytically competent binding mode of CoA in the active site The pantetheine binding tunnel of biosynthetic thiolase When CoA binds to Z ramigera biosynthetic ... thiolase superfamily The results obtained indicate that the sulfur atoms of both the enzyme and the substrate are important for the...
Ngày tải lên: 16/03/2014, 04:20
Low-Iodine Cookbook: Guidelines and Tips for the Low-Iodine Diet Used for a Short Time When Preparing To Receive Radioactive Iodine docx
... stewed tomatoes and unsalted tomato sauce, garlic, basil, and oregano to a saucepan (use a potato masher to mash up stewed tomatoes in the pan) Let simmer Brown the chopped meat and strain any fat, ... min) Add vegetables back to heat Eat plain or over salad to make a great fajita salad Or serve in corn tortillas made with only corn, lime, and water Another variation...
Ngày tải lên: 22/03/2014, 16:21
Báo cáo khoa học: A novel factor XI missense mutation (Val371Ile) in the activation loop is responsible for a case of mild type II factor XI deficiency doc
... binding of the C-terminal domain of hirudin and amidase activity in human alpha-thrombin Biochem J 289, 475480 Baglia FA & Walsh PN (1996) A binding site for thrombin in the apple domain of factor ... coagulation factor XI deciency in six Italian patients Haematologica 89, 13321340 Naito K & Fujikawa K (1991) Activation of human blood coagulation factor XI in...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: The light-harvesting antenna of the diatom Phaeodactylum tricornutum Evidence for a diadinoxanthin-binding subcomplex doc
... contents: 0.5 lg for LHCo (lane of part A) and for LHCo-2 (lanes and of part B); and 0.1 lg for LHCo-1 and LHCo-2 (lanes and of part A) and lanes and of part B higher plant LHC antennae that pigment–protein ... 26 and 29) components of the LHC [24,25] In diatoms, DD and DT are mainly associated with the FCP antenna [12], but their exact localization in the different...
Ngày tải lên: 30/03/2014, 20:20
báo cáo hóa học: " On the solvability conditions of the first boundary value problem for a system of elliptic equations that strongly degenerate at a point" pdf
... equations, diagonal systems and variational integrals Manuscripta Math 55, 467–486 (1986) doi:10.1007/BF01186659 Rutkauskas, S: On the first boundary value problem for the class of elliptic systems ... degenerating at an inner point Math Model Anal 6(1), 147–155 (2001) Rutkauskas, S: On the Dirichlet problem for a system of degenerate at a point ell...
Ngày tải lên: 21/06/2014, 00:20
báo cáo khoa học: " Evaluating the effectiveness of a tailored multifaceted performance feedback intervention to improve the quality of care: protocol for a cluster randomized trial in intensive care" pps
... involved in QI activities The team’s main tasks are described in a protocol and include formulating a QI action plan, monitoring of performance using the feedback reports, and initiating and evaluating ... this article as: van der Veer et al.: Evaluating the effectiveness of a tailored multifaceted performance feedback intervention to improve the...
Ngày tải lên: 10/08/2014, 11:20
Báo cáo y học: "The clinical assessment study of the foot (CASF): study protocol for a prospective observational study of foot pain and foot osteoarthritis in the general population" docx
... methods of data-gathering In the clinical assessment phase of the study, the clinical interview and physical assessment, ultrasound, digital images, plantar pressure and the taking and scoring of ... line-drawings for each foot depicting increasing severity of hallux valgus In the past weeks, have you had pain that has lasted for one day or longer...
Ngày tải lên: 10/08/2014, 21:24
The Jeans Industry - How much for a pair of Jeans and Who actually Pays
... or jeans buttons, labels (usually imitation leather), and optionally a zipper to make a pair of jeans An average jeans factory can make about 2.500 pair of jeans per day A stonewash for 150 pairs ... Many workers suffer lung damage • Crops and livestock are also affected • People can afford education and healthcare What if the mine was to close again? Muna Mbu...
Ngày tải lên: 09/08/2015, 01:23
a suficient condition for the existence of periodic solution for a reation diffusion equation with infinite delay
... xÞ, then the quasi -solution hðt; xÞ (or hðt; xÞ) is exactly the solution, and the asymptotic behavior of the solutions to the associated initial boundary value problem is also obtained Therefore, ... infinite delay, Nonlinear Anal., TMA 44 (2001) 97–121 [3] L Zhou, Y Fu, Existence and stability of periodic quasisolutions in nonlinear parabolic systems with discrete dela...
Ngày tải lên: 29/10/2015, 14:20
The age of complicance preparing for a riskier and more regulated world
... The age of compliance Preparing for a riskier and more regulated world Preface The age of compliance: Preparing for a riskier and more regulated world is an Economist Intelligence ... Armstrong was the editor August 2010 © The Economist Intelligence Unit Limited 2010 The age of compliance Preparing for a riskier and more regul...
Ngày tải lên: 06/12/2015, 23:14
The sharper mind mental games for a keen mind and a foolproof memory
... serves as a kind of temporary scratch pad Once you have made the calculation, paid the bill, filled the order, and so on, the data leave your mind and you have a clean slate for more temporary or ... introduced to Barbara Make associations with another Barbara you know How are they alike? How are they different? Associate your new acquaintance with a celebrity such as Ba...
Ngày tải lên: 05/04/2016, 18:57
A NEW CLASSIFICATION SYSTEM FOR URBAN STORMWATER POLLUTANT LOADING: A CASE STUDY IN THE SANTA MONICA BAY AREA
... identifying the areas that discharge high pollutant loading into receiving waters METHODS Our area of interest was Marina del Rey and its vicinity in the Santa Monica Bay Watershed Santa Monica Bay ... loading areas, which were classified as public land use in the SCAG data and USGS classification system Recreational facilities including parks were also classifie...
Ngày tải lên: 05/09/2013, 09:08
Tài liệu Báo cáo khoa học: Characterization of promoter 3 of the human thromboxane A2 receptor gene A functional AP-1 and octamer motif are required for basal promoter activity docx
... Prm3 was performed using the mutator primers Kin175 (5¢-CACCAGAGCTACTTACA CTGAATTCCAGAATAATCACAAGCAAATC -3 ; sense primer) vs its complement generating pGL3b:Prm3aOCT)1*, pGL3b:Prm3abOCT)1* and ... Prm3aaAP)1*, pGL3e:Prm3aaAP)1*, pGL3b:Prm3aaaAP)1* and pGL3e:Prm3aaaAP)1* Mutation of the Oct-1 element with the sequence aaA TGCa to aaTTCCa (core bases shown in uppercase letters) cen...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... TGGACGGATATTGAAGCTGATCTCACCATAAAGGAT ATCCTTTATGGTGAGATCAGCTTCAATATCCGTCCA TTAAAGGCTATCAAATCGCAAGAACAGTTCACTAGA TCTAGTGAACTGTTCTTGCGATTTGATAGCCTTTAA GAAGCAAGAACAGTTCACTTAGTCAATTGATTAACGTG CACGTTAATCAATTGACTAAGTGAACTGTTCTTGCTTC ... be other meiotic clade AAA ATPases and have the AAA domain helix and the C-terminal helix, but not the b domain The distinguishing featu...
Ngày tải lên: 07/03/2014, 05:20