The use of a frailty index to predict adverse health outcomes (falls, fractures, hospitalization, medication use, comorbid conditions) in people with intellectual disabilities

Báo cáo y học: " Act In case of Depression: The evaluation of a care program to improve the detection and treatment of depression in nursing homes. Study Protocol" pptx

Báo cáo y học: " Act In case of Depression: The evaluation of a care program to improve the detection and treatment of depression in nursing homes. Study Protocol" pptx

... program Act In case of Depression (AID), a multidisciplinary care program to identify and treat depression and monitor treatment effects The care program is based on and in accordance with the ... Gerritsen et al.: Act In case of Depression: The evaluation of a care program to improve the detection and treatment of...

Ngày tải lên: 11/08/2014, 15:22

7 484 0
Báo cáo y học: "A pilot study of a new test to predict extubation failure" pps

Báo cáo y học: "A pilot study of a new test to predict extubation failure" pps

... time The patients that were unable to tolerate the additional dead space had an extubation failure rate of 75% These patients had been mechanically ventilated for a mean of 16 days and had higher ... extubated The anatomic dead space comprised in the upper airways and the intrathoracic airways is approximately ml/kg, that is about 150 ml in a normal adult [22] A study in cadav...

Ngày tải lên: 13/08/2014, 16:20

9 331 0
Báo cáo khoa học: "The humus of a "Parabraunerde" (Orthic Luvisol) under Fagus sylvatica L and Quercus robur L and its modification in 25 years" docx

Báo cáo khoa học: "The humus of a "Parabraunerde" (Orthic Luvisol) under Fagus sylvatica L and Quercus robur L and its modification in 25 years" docx

... MATERIALS AND METHODS A loamy Orthic Luvisol (Typische Parabrau- nerde, Typic Hapludalf, Sol brun lessivé) formed in the Weichselian boulder marl over fluvioglacial sands was investigated It is located ... earth worm faeces contain ≈ 50% mineral particles 30% leaf and pod Ah1 (2-5) Sandy loam, little litter and many animal faeces (0.26 g/cm The worm faeces (giv) ing a crumb str...

Ngày tải lên: 08/08/2014, 23:22

12 210 0
Báo cáo y học: " Reproducibility of the airway response to an exercise protocol standardized for intensity, duration, and inspired air conditions, in subjects with symptoms suggestive of asthma" pdf

Báo cáo y học: " Reproducibility of the airway response to an exercise protocol standardized for intensity, duration, and inspired air conditions, in subjects with symptoms suggestive of asthma" pdf

... likely to be referred for exercise testing for EIB Exercise testing to identify EIB in the laboratory is affected by the type of exercise, intensity and duration of exercise, inspired air conditions, ... appreciated the opportunity afforded by design of the protocol standardized for the intensity and duration of exercise, and the conditio...

Ngày tải lên: 12/08/2014, 11:22

12 303 0
Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx

Tài liệu The Book Of Personal Transformation - How To Use Ancient Wisdom To Create A New Life For Yourself docx

... Personal TRANSFORMATION How to Use Ancient Wisdom to Create a New Life of Success and Happiness For Yourself Dr Tim Ong M.B.B.S Personal TRANSFORMATION How to Use Ancient Wisdom to Create A New ... manifest what they visualised in their lives AFFIRMATIONS Jeff Staniforth, the creator of Sculptor 3, an amazing software that can make affir...

Ngày tải lên: 15/12/2013, 06:15

59 771 3
báo cáo hóa học:" The use of average Pavlov ratio to predict the risk of post operative upper limb palsy after posterior cervical decompression" pot

báo cáo hóa học:" The use of average Pavlov ratio to predict the risk of post operative upper limb palsy after posterior cervical decompression" pot

... concluded that Average Pavlov ratio might be a useful predictor to cervical myelopathy [17] However, the association of narrow spinal canal with the risk of post operative upper limb palsy has not ... myeloradiculopathy, the distribution of Average Pavlov ratio is expected to be skewed instead of normal, which justified the transformation of th...

Ngày tải lên: 20/06/2014, 04:20

9 325 0
A Companion to the History of Economic Thought - Index pdf

A Companion to the History of Economic Thought - Index pdf

... Alternative Economic Strategy 193 American Association for the Advancement of Science 240 American Association of Labor Legislation 371 American Civil War 141, 235–6, 237 American Council of Learned ... analysis of economic interactions 16–21 analytic structure (classical approach to value/distribution) 180–1 ancien régime 54, 75, 627 ancient economics 11–24 Annales school 495...

Ngày tải lên: 06/07/2014, 03:20

44 311 0
Báo cáo y học: "A standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populations" pdf

Báo cáo y học: "A standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populations" pdf

... et al.: A standardized scoring method for the copy of cube test, developed to be suitable for use in psychiatric populations Annals of General Psychiatry 2011 10:19 Competing interests The authors ... been developed The aims of the current study were to develop a novel and detailed standardized method of administration and scoring of...

Ngày tải lên: 09/08/2014, 01:21

10 475 0
báo cáo khoa học: " Assessing organisational readiness for change: use of diagnostic analysis prior to the implementation of a multidisciplinary assessment for acute stroke care" doc

báo cáo khoa học: " Assessing organisational readiness for change: use of diagnostic analysis prior to the implementation of a multidisciplinary assessment for acute stroke care" doc

... interviews, documentary analysis, and a questionnaire to identify team climate can be used to collect data to identify the barriers and facilitators to change Furthermore, such a broad approach to data ... use of a theoretical framework to underpin the diagnostic analysis has resulted in the collection of a far broader range of data than if a purely em...

Ngày tải lên: 11/08/2014, 05:22

11 319 0
Báo cáo y học: " Analysis of the replication of HIV-1 forced to use tRNAMet(i) supports a link between primer selection, translation and encapsidation" ppsx

Báo cáo y học: " Analysis of the replication of HIV-1 forced to use tRNAMet(i) supports a link between primer selection, translation and encapsidation" ppsx

... 5'aattTAATACGACTCACTATAGGcccggatagctcagtcgg 3' and 5'cgcccgaacagggacttgaaccctgg accctcagattaaaagtctgatgctctaccgactgagctatccgggc 3' (tRNALys,3); 5' aattTAATACGACTCACTATAGGcctcgttagcgcagtagg 3' and ... tgccccgtgtgaggatcgaactcacg accttcagattatgagactgacgcgctacctactgcgctaacgagg (tRNAMet(e)); 5' aattTAATACGACTCACTATAGGagcagagtggcgcagcgg 3' and 5' tagcagaggatggtttcgatccatcg acctctgggttatgggccc...

Ngày tải lên: 13/08/2014, 09:20

14 189 0
Study on corporate governance index of Vietnam commercial bank –  the case of a newly established, medium to large  joint stock commercial ban

Study on corporate governance index of Vietnam commercial bank – the case of a newly established, medium to large joint stock commercial ban

... influenced by the management style of a market economy after privatization The bank is a medium to large joint stock commercial banks in Vietnam For these reasons, corporate governance of the bank is ... out of 44 Vietnam banks - Its performance (ROA) ranked among top 20 banks Secondary information and data of the bank includes the bank annual...

Ngày tải lên: 02/01/2015, 17:33

8 433 2
A study on the reality of teaching speaking skill to non english majors at thai nguyen university college of technologyrelevan

A study on the reality of teaching speaking skill to non english majors at thai nguyen university college of technologyrelevan

... communication, the skill of speaking and difficulties in teaching speaking skill 1.1 Nature of Language skills and oral communication 1.1.1 Nature of Language skills For the purpose of analysis and ... using appropriate conversational formulae and filters 1.2 The skill of speaking 1.2.1 The role and status of speaking in language learning and teaching As...

Ngày tải lên: 07/09/2013, 13:06

73 1,4K 4
Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc

Tài liệu HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE doc

... not the amount of relationships since firms have the help of sophisticated information systems and data warehouses been able to manage a great deal of data The challenge is to capture and measure ... HOW TO MEASURE THE IMPACT OF A CRM STRATEGY ON THE FIRM PERFORMANCE ABSTRACT CRM strategy (Customer Relationship Management) is a business phil...

Ngày tải lên: 20/12/2013, 17:15

15 797 0
Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf

Tài liệu A Case Study on the Implementation of A Knowledge Management Strategy Oriented to Innovation pdf

... success factors in the implementation of KM A Knowledge Management Strategy Oriented to Innovation 167 CASE STUDY Knowledge and Process Management SUCCESS FACTORS IN THE STRATEGY S IMPLEMENTATION The ... technological innovation and the creation, accumulation and transmission of knowledge F J Forcadell and F Guadamillas Knowledge and Process Manag...

Ngày tải lên: 24/01/2014, 00:20

10 1,1K 1
w